Human NFKBIA/IKBA/MAD-3 ORF/cDNA clone-Adenovirus plasmid (BC002601)

Cat. No.: pGMAP000119
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human NFKBIA/IKBA/MAD-3 adenoviral expression plasmid for NFKBIA adenovirus packaging, NFKBIA adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to NFKBIA/IKBA products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP000119
Gene Name NFKBIA
Accession Number BC002601
Gene ID 4792
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 954 bp
Gene Alias IKBA,MAD-3
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGTTCCAGGCGGCCGAGCGCCCCCAGGAGTGGGCCATGGAGGGCCCCCGCGACGGGCTGAAGAAGGAGCGGCTACTGGACGACCGCCACGACAGCGGCCTGGACTCCATGAAAGACGAGGAGTACGAGCAGATGGTCAAGGAGCTGCAGGAGATCCGCCTCGAGCCGCAGGAGGTGCCGCGCGGCTCGGAGCCCTGGAAGCAGCAGCTCACCGAGGACGGGGACTCGTTCCTGCACTTGGCCATCATCCATGAAGAAAAGGCACTGACCATGGAAGTGATCCGCCAGGTGAAGGGAGACCTGGCCTTCCTCAACTTCCAGAACAACCTGCAGCAGACTCCACTCCACTTGGCTGTGATCACCAACCAGCCAGAAATTGCTGAGGCACTTCTGGGAGCTGGCTGTGATCCTGAGCTCCGAGACTTTCGAGGAAATACCCCCCTACACCTTGCCTGTGAGCAGGGCTGCCTGGCCAGCGTGGGAGTCCTGACTCAGTCCTGCACCACCCCGCACCTCCACTCCATCCTGAAGGCTACCAACTACAATGGCCACACGTGTCTACACTTAGCCTCTATCCATGGCTACCTGGGCATCGTGGAGCTTTTGGTGTCCTTGGGTGCTGATGTCAATGCTCAGGAGCCCTGTAATGGCCGGACTGCCCTTCACCTCGCAGTGGACCTGCAAAATCCTGACCTGGTGTCACTCCTGTTGAAGTGTGGGGCTGATGTCAACAGAGTTACCTACCAGGGCTATTCTCCCTACCAGCTCACCTGGGGCCGCCCAAGCACCCGGATACAGCAGCAGCTGGGCCAGCTGACACTAGAAAACCTTCAGATGCTGCCAGAGAGTGAGGATGAGGAGAGCTATGACACAGAGTCAGAGTTCACGGAGTTCACAGAGGACGAGCTGCCCTATGATGACTGTGTGTTTGGAGGCCAGCGTCTGACGTTATGA
ORF Protein Sequence MFQAAERPQEWAMEGPRDGLKKERLLDDRHDSGLDSMKDEEYEQMVKELQEIRLEPQEVPRGSEPWKQQLTEDGDSFLHLAIIHEEKALTMEVIRQVKGDLAFLNFQNNLQQTPLHLAVITNQPEIAEALLGAGCDPELRDFRGNTPLHLACEQGCLASVGVLTQSCTTPHLHSILKATNYNGHTCLHLASIHGYLGIVELLVSLGADVNAQEPCNGRTALHLAVDLQNPDLVSLLLKCGADVNRVTYQGYSPYQLTWGRPSTRIQQQLGQLTLENLQMLPESEDEESYDTESEFTEFTEDELPYDDCVFGGQRLTL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T51672-Ab Anti-NFKBIA monoclonal antibody
    Target Antigen GM-Tg-g-T51672-Ag NFKBIA protein
    ORF Viral Vector pGMLV000540 Human NFKBIA Lentivirus plasmid
    ORF Viral Vector pGMAP000119 Human NFKBIA Adenovirus plasmid
    ORF Viral Vector vGMLV000540 Human NFKBIA Lentivirus particle
    ORF Viral Vector vGMAP000119 Human NFKBIA Adenovirus particle


    Target information

    Target ID GM-T51672
    Target Name NFKBIA
    Gene ID 4792, 18035, 695335, 25493, 101090622, 480291, 282291, 100058000
    Gene Symbol and Synonyms EDAID2,IKBA,MAD-3,NFKBI,NFKBIA,RL/IF-1
    Uniprot Accession P25963
    Uniprot Entry Name IKBA_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000100906
    Target Classification Pathway

    This gene encodes a member of the NF-kappa-B inhibitor family, which contain multiple ankrin repeat domains. The encoded protein interacts with REL dimers to inhibit NF-kappa-B/REL complexes which are involved in inflammatory responses. The encoded protein moves between the cytoplasm and the nucleus via a nuclear localization signal and CRM1-mediated nuclear export. Mutations in this gene have been found in ectodermal dysplasia anhidrotic with T-cell immunodeficiency autosomal dominant disease. [provided by RefSeq, Aug 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.