Human NFKBIA/IKBA/ MAD-3 ORF/cDNA clone-Adenovirus particle (BC002601)
Pre-made Human NFKBIA/IKBA/ MAD-3 Adenovirus for NFKBIA overexpression in-vitro and in-vivo. The NFKBIA adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified NFKBIA-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to NFKBIA/IKBA products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000119 | Human NFKBIA Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000119 |
Gene Name | NFKBIA |
Accession Number | BC002601 |
Gene ID | 4792 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 954 bp |
Gene Alias | IKBA, MAD-3 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTTCCAGGCGGCCGAGCGCCCCCAGGAGTGGGCCATGGAGGGCCCCCGCGACGGGCTGAAGAAGGAGCGGCTACTGGACGACCGCCACGACAGCGGCCTGGACTCCATGAAAGACGAGGAGTACGAGCAGATGGTCAAGGAGCTGCAGGAGATCCGCCTCGAGCCGCAGGAGGTGCCGCGCGGCTCGGAGCCCTGGAAGCAGCAGCTCACCGAGGACGGGGACTCGTTCCTGCACTTGGCCATCATCCATGAAGAAAAGGCACTGACCATGGAAGTGATCCGCCAGGTGAAGGGAGACCTGGCCTTCCTCAACTTCCAGAACAACCTGCAGCAGACTCCACTCCACTTGGCTGTGATCACCAACCAGCCAGAAATTGCTGAGGCACTTCTGGGAGCTGGCTGTGATCCTGAGCTCCGAGACTTTCGAGGAAATACCCCCCTACACCTTGCCTGTGAGCAGGGCTGCCTGGCCAGCGTGGGAGTCCTGACTCAGTCCTGCACCACCCCGCACCTCCACTCCATCCTGAAGGCTACCAACTACAATGGCCACACGTGTCTACACTTAGCCTCTATCCATGGCTACCTGGGCATCGTGGAGCTTTTGGTGTCCTTGGGTGCTGATGTCAATGCTCAGGAGCCCTGTAATGGCCGGACTGCCCTTCACCTCGCAGTGGACCTGCAAAATCCTGACCTGGTGTCACTCCTGTTGAAGTGTGGGGCTGATGTCAACAGAGTTACCTACCAGGGCTATTCTCCCTACCAGCTCACCTGGGGCCGCCCAAGCACCCGGATACAGCAGCAGCTGGGCCAGCTGACACTAGAAAACCTTCAGATGCTGCCAGAGAGTGAGGATGAGGAGAGCTATGACACAGAGTCAGAGTTCACGGAGTTCACAGAGGACGAGCTGCCCTATGATGACTGTGTGTTTGGAGGCCAGCGTCTGACGTTATGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T51672-Ab | Anti-NFKBIA monoclonal antibody |
Target Antigen | GM-Tg-g-T51672-Ag | NFKBIA protein |
ORF Viral Vector | pGMLV000540 | Human NFKBIA Lentivirus plasmid |
ORF Viral Vector | pGMAD000047 | Rat Nfkbia Adenovirus plasmid |
ORF Viral Vector | pGMAP000119 | Human NFKBIA Adenovirus plasmid |
ORF Viral Vector | vGMLV000540 | Human NFKBIA Lentivirus particle |
ORF Viral Vector | vGMAD000047 | Rat Nfkbia Adenovirus particle |
ORF Viral Vector | vGMAP000119 | Human NFKBIA Adenovirus particle |
Target information
Target ID | GM-T51672 |
Target Name | NFKBIA |
Gene ID | 4792, 18035, 695335, 25493, 101090622, 480291, 282291, 100058000 |
Gene Symbol and Synonyms | EDAID2,IKBA,MAD-3,NFKBI,NFKBIA,RL/IF-1 |
Uniprot Accession | P25963 |
Uniprot Entry Name | IKBA_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000100906 |
Target Classification | Pathway |
This gene encodes a member of the NF-kappa-B inhibitor family, which contain multiple ankrin repeat domains. The encoded protein interacts with REL dimers to inhibit NF-kappa-B/REL complexes which are involved in inflammatory responses. The encoded protein moves between the cytoplasm and the nucleus via a nuclear localization signal and CRM1-mediated nuclear export. Mutations in this gene have been found in ectodermal dysplasia anhidrotic with T-cell immunodeficiency autosomal dominant disease. [provided by RefSeq, Aug 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.