Human MAPK9/JNK-55/JNK2 ORF/cDNA clone-Adenovirus plasmid (BC032539)

Cat. No.: pGMAP000176
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MAPK9/JNK-55/JNK2 adenoviral expression plasmid for MAPK9 adenovirus packaging, MAPK9 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.


Target products collection

Go to JNK2/MAPK9/JNK-55 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP000176
Gene Name MAPK9
Accession Number BC032539
Gene ID 5601
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 1275 bp
Gene Alias JNK-55,JNK2,JNK2A,JNK2ALPHA,JNK2B,JNK2BETA,p54aSAPK
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGAGCGACAGTAAATGTGACAGTCAGTTTTATAGTGTGCAAGTGGCAGACTCAACCTTCACTGTCCTAAAACGTTACCAGCAGCTGAAACCAATTGGCTCTGGGGCCCAAGGGATTGTTTGTGCTGCATTTGATACAGTTCTTGGGATAAATGTTGCAGTCAAGAAACTAAGCCGTCCTTTTCAGAACCAAACTCATGCAAAGAGAGCTTATCGTGAACTTGTCCTCTTAAAATGTGTCAATCATAAAAATATAATTAGTTTGTTAAATGTGTTTACACCACAAAAAACTCTAGAAGAATTTCAAGATGTGTATTTGGTTATGGAATTAATGGATGCTAACTTATGTCAGGTTATTCACATGGAGCTGGATCATGAAAGAATGTCCTACCTTCTTTACCAGATGCTTTGTGGTATTAAACATCTGCATTCAGCTGGTATAATTCATAGAGATTTGAAGCCTAGCAACATTGTTGTGAAATCAGACTGCACCCTGAAGATCCTTGACTTTGGCCTGGCCCGGACAGCGTGCACTAACTTCATGATGACCCCTTACGTGGTGACACGGTACTACCGGGCGCCCGAAGTCATCCTGGGTATGGGCTACAAAGAGAACGTTGATATCTGGTCAGTGGGTTGCATCATGGGAGAGCTGGTGAAAGGTTGTGTGATATTCCAAGGCACTGACCATATTGATCAGTGGAATAAAGTTATTGAGCAGCTGGGAACACCATCAGCAGAGTTCATGAAGAAACTTCAGCCAACTGTGAGGAATTATGTCGAAAACAGACCAAAGTATCCTGGAATCAAATTTGAAGAACTCTTTCCAGATTGGATATTCCCATCAGAATCTGAGCGAGACAAAATAAAAACAAGTCAAGCCAGAGATCTGTTATCAAAAATGTTAGTGATTGATCCTGACAAGCGGATCTCTGTAGACGAAGCTCTGCGTCACCCATACATCACTGTTTGGTATGACCCCGCCGAAGCAGAAGCCCCACCACCTCAAATTTATGATGCCCAGTTGGAAGAAAGAGAACATGCAATTGAAGAATGGAAAGAGCTAATTTACAAAGAAGTCATGGATTGGGAAGAAAGAAGCAAGAATGGTGTTGTAAAAGATCAGCCTTCAGATGCAGCAGTAAGTAGCAACGCCACTCCTTCTCAGTCTTCATCGATCAATGACATTTCATCCATGTCCACTGAGCAGACGCTGGCCTCAGACACAGACAGCAGTCTTGATGCCTCGACGGGACCCCTTGAAGGCTGTCGATGA
ORF Protein Sequence MSDSKCDSQFYSVQVADSTFTVLKRYQQLKPIGSGAQGIVCAAFDTVLGINVAVKKLSRPFQNQTHAKRAYRELVLLKCVNHKNIISLLNVFTPQKTLEEFQDVYLVMELMDANLCQVIHMELDHERMSYLLYQMLCGIKHLHSAGIIHRDLKPSNIVVKSDCTLKILDFGLARTACTNFMMTPYVVTRYYRAPEVILGMGYKENVDIWSVGCIMGELVKGCVIFQGTDHIDQWNKVIEQLGTPSAEFMKKLQPTVRNYVENRPKYPGIKFEELFPDWIFPSESERDKIKTSQARDLLSKMLVIDPDKRISVDEALRHPYITVWYDPAEAEAPPPQIYDAQLEEREHAIEEWKELIYKEVMDWEERSKNGVVKDQPSDAAVSSNATPSQSSSINDISSMSTEQTLASDTDSSLDASTGPLEGCR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T69375-Ab Anti-JNK2 monoclonal antibody
    Target Antigen GM-Tg-g-T69375-Ag JNK2/MAPK9 protein
    ORF Viral Vector pGMLP000516 Human MAPK9 Lentivirus plasmid
    ORF Viral Vector pGMLP005803 Human MAPK9 Lentivirus plasmid
    ORF Viral Vector pGMAP000176 Human MAPK9 Adenovirus plasmid
    ORF Viral Vector vGMLP000516 Human MAPK9 Lentivirus particle
    ORF Viral Vector vGMLP005803 Human MAPK9 Lentivirus particle
    ORF Viral Vector vGMAP000176 Human MAPK9 Adenovirus particle


    Target information

    Target ID GM-T69375
    Target Name JNK2
    Gene ID 5601, 26420, 715782, 50658, 101084765, 474652, 534125, 100057961
    Gene Symbol and Synonyms JNK-55,JNK2,JNK2A,JNK2ALPHA,JNK2B,JNK2BETA,MAPK9,p54a,p54aSAPK,PRKM9,SAPK,SAPK1a
    Uniprot Accession P45984
    Uniprot Entry Name MK09_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000050748
    Target Classification Kinase

    The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase targets specific transcription factors, and thus mediates immediate-early gene expression in response to various cell stimuli. It is most closely related to MAPK8, both of which are involved in UV radiation induced apoptosis, thought to be related to the cytochrome c-mediated cell death pathway. This gene and MAPK8 are also known as c-Jun N-terminal kinases. This kinase blocks the ubiquitination of tumor suppressor p53, and thus it increases the stability of p53 in nonstressed cells. Studies of this gene's mouse counterpart suggest a key role in T-cell differentiation. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Sep 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.