Human MAPK9/JNK-55/JNK2 ORF/cDNA clone-Lentivirus particle (NM_002752)

Cat. No.: vGMLP000516

Pre-made Human MAPK9/JNK-55/JNK2 Lentiviral expression plasmid for MAPK9 lentivirus packaging, MAPK9 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to JNK2/MAPK9/JNK-55 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000516 Human MAPK9 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000516
Gene Name MAPK9
Accession Number NM_002752
Gene ID 5601
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1275 bp
Gene Alias JNK-55,JNK2,JNK2A,JNK2ALPHA,JNK2B,JNK2BETA,p54a,p54aSAPK,PRKM9,SAPK,SAPK1a
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGCGACAGTAAATGTGACAGTCAGTTTTATAGTGTGCAAGTGGCAGACTCAACCTTCACTGTCCTAAAACGTTACCAGCAGCTGAAACCAATTGGCTCTGGGGCCCAAGGGATTGTTTGTGCTGCATTTGATACAGTTCTTGGGATAAATGTTGCAGTCAAGAAACTAAGCCGTCCTTTTCAGAACCAAACTCATGCAAAGAGAGCTTATCGTGAACTTGTCCTCTTAAAATGTGTCAATCATAAAAATATAATTAGTTTGTTAAATGTGTTTACACCACAAAAAACTCTAGAAGAATTTCAAGATGTGTATTTGGTTATGGAATTAATGGATGCTAACTTATGTCAGGTTATTCACATGGAGCTGGATCATGAAAGAATGTCCTACCTTCTTTACCAGATGCTTTGTGGTATTAAACATCTGCATTCAGCTGGTATAATTCATAGAGATTTGAAGCCTAGCAACATTGTTGTGAAATCAGACTGCACCCTGAAGATCCTTGACTTTGGCCTGGCCCGGACAGCGTGCACTAACTTCATGATGACCCCTTACGTGGTGACACGGTACTACCGGGCGCCCGAAGTCATCCTGGGTATGGGCTACAAAGAGAACGTTGATATCTGGTCAGTGGGTTGCATCATGGGAGAGCTGGTGAAAGGTTGTGTGATATTCCAAGGCACTGACCATATTGATCAGTGGAATAAAGTTATTGAGCAGCTGGGAACACCATCAGCAGAGTTCATGAAGAAACTTCAGCCAACTGTGAGGAATTATGTCGAAAACAGACCAAAGTATCCTGGAATCAAATTTGAAGAACTCTTTCCAGATTGGATATTCCCATCAGAATCTGAGCGAGACAAAATAAAAACAAGTCAAGCCAGAGATCTGTTATCAAAAATGTTAGTGATTGATCCTGACAAGCGGATCTCTGTAGACGAAGCTCTGCGTCACCCATACATCACTGTTTGGTATGACCCCGCCGAAGCAGAAGCCCCACCACCTCAAATTTATGATGCCCAGTTGGAAGAAAGAGAACATGCAATTGAAGAATGGAAAGAGCTAATTTACAAAGAAGTCATGGATTGGGAAGAAAGAAGCAAGAATGGTGTTGTAAAAGATCAGCCTTCAGATGCAGCAGTAAGTAGCAACGCCACTCCTTCTCAGTCTTCATCGATCAATGACATTTCATCCATGTCCACTGAGCAGACGCTGGCCTCAGACACAGACAGCAGTCTTGATGCCTCGACGGGACCCCTTGAAGGCTGTCGATGA
ORF Protein Sequence MSDSKCDSQFYSVQVADSTFTVLKRYQQLKPIGSGAQGIVCAAFDTVLGINVAVKKLSRPFQNQTHAKRAYRELVLLKCVNHKNIISLLNVFTPQKTLEEFQDVYLVMELMDANLCQVIHMELDHERMSYLLYQMLCGIKHLHSAGIIHRDLKPSNIVVKSDCTLKILDFGLARTACTNFMMTPYVVTRYYRAPEVILGMGYKENVDIWSVGCIMGELVKGCVIFQGTDHIDQWNKVIEQLGTPSAEFMKKLQPTVRNYVENRPKYPGIKFEELFPDWIFPSESERDKIKTSQARDLLSKMLVIDPDKRISVDEALRHPYITVWYDPAEAEAPPPQIYDAQLEEREHAIEEWKELIYKEVMDWEERSKNGVVKDQPSDAAVSSNATPSQSSSINDISSMSTEQTLASDTDSSLDASTGPLEGCR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T69375-Ab Anti-JNK2 monoclonal antibody
    Target Antigen GM-Tg-g-T69375-Ag JNK2/MAPK9 protein
    ORF Viral Vector pGMLP000516 Human MAPK9 Lentivirus plasmid
    ORF Viral Vector pGMLP005803 Human MAPK9 Lentivirus plasmid
    ORF Viral Vector pGMAP000176 Human MAPK9 Adenovirus plasmid
    ORF Viral Vector vGMLP000516 Human MAPK9 Lentivirus particle
    ORF Viral Vector vGMLP005803 Human MAPK9 Lentivirus particle
    ORF Viral Vector vGMAP000176 Human MAPK9 Adenovirus particle


    Target information

    Target ID GM-T69375
    Target Name JNK2
    Gene ID 5601, 26420, 715782, 50658, 101084765, 474652, 534125, 100057961
    Gene Symbol and Synonyms JNK-55,JNK2,JNK2A,JNK2ALPHA,JNK2B,JNK2BETA,MAPK9,p54a,p54aSAPK,PRKM9,SAPK,SAPK1a
    Uniprot Accession P45984
    Uniprot Entry Name MK09_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000050748
    Target Classification Kinase

    The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase targets specific transcription factors, and thus mediates immediate-early gene expression in response to various cell stimuli. It is most closely related to MAPK8, both of which are involved in UV radiation induced apoptosis, thought to be related to the cytochrome c-mediated cell death pathway. This gene and MAPK8 are also known as c-Jun N-terminal kinases. This kinase blocks the ubiquitination of tumor suppressor p53, and thus it increases the stability of p53 in nonstressed cells. Studies of this gene's mouse counterpart suggest a key role in T-cell differentiation. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Sep 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.