Human MAPK9/JNK-55/JNK2 ORF/cDNA clone-Lentivirus particle (NM_002752.4)
Cat. No.: vGMLP005803
Pre-made Human MAPK9/JNK-55/JNK2 Lentiviral expression plasmid for MAPK9 lentivirus packaging, MAPK9 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
JNK2/MAPK9/JNK-55 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP005803 | Human MAPK9 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP005803 |
Gene Name | MAPK9 |
Accession Number | NM_002752.4 |
Gene ID | 5601 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1275 bp |
Gene Alias | JNK-55,JNK2,JNK2A,JNK2ALPHA,JNK2B,JNK2BETA,p54a,p54aSAPK,PRKM9,SAPK,SAPK1a |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGAGCGACAGTAAATGTGACAGTCAGTTTTATAGTGTGCAAGTGGCAGACTCAACCTTCACTGTCCTAAAACGTTACCAGCAGCTGAAACCAATTGGCTCTGGGGCCCAAGGGATTGTTTGTGCTGCATTTGATACAGTTCTTGGGATAAATGTTGCAGTCAAGAAACTAAGCCGTCCTTTTCAGAACCAAACTCATGCAAAGAGAGCTTATCGTGAACTTGTCCTCTTAAAATGTGTCAATCATAAAAATATAATTAGTTTGTTAAATGTGTTTACACCACAAAAAACTCTAGAAGAATTTCAAGATGTGTATTTGGTTATGGAATTAATGGATGCTAACTTATGTCAGGTTATTCACATGGAGCTGGATCATGAAAGAATGTCCTACCTTCTTTACCAGATGCTTTGTGGTATTAAACATCTGCATTCAGCTGGTATAATTCATAGAGATTTGAAGCCTAGCAACATTGTTGTGAAATCAGACTGCACCCTGAAGATCCTTGACTTTGGCCTGGCCCGGACAGCGTGCACTAACTTCATGATGACCCCTTACGTGGTGACACGGTACTACCGGGCGCCCGAAGTCATCCTGGGTATGGGCTACAAAGAGAACGTTGATATCTGGTCAGTGGGTTGCATCATGGGAGAGCTGGTGAAAGGTTGTGTGATATTCCAAGGCACTGACCATATTGATCAGTGGAATAAAGTTATTGAGCAGCTGGGAACACCATCAGCAGAGTTCATGAAGAAACTTCAGCCAACTGTGAGGAATTATGTCGAAAACAGACCAAAGTATCCTGGAATCAAATTTGAAGAACTCTTTCCAGATTGGATATTCCCATCAGAATCTGAGCGAGACAAAATAAAAACAAGTCAAGCCAGAGATCTGTTATCAAAAATGTTAGTGATTGATCCTGACAAGCGGATCTCTGTAGACGAAGCTCTGCGTCACCCATACATCACTGTTTGGTATGACCCCGCCGAAGCAGAAGCCCCACCACCTCAAATTTATGATGCCCAGTTGGAAGAAAGAGAACATGCAATTGAAGAATGGAAAGAGCTAATTTACAAAGAAGTCATGGATTGGGAAGAAAGAAGCAAGAATGGTGTTGTAAAAGATCAGCCTTCAGATGCAGCAGTAAGTAGCAACGCCACTCCTTCTCAGTCTTCATCGATCAATGACATTTCATCCATGTCCACTGAGCAGACGCTGGCCTCAGACACAGACAGCAGTCTTGATGCCTCGACGGGACCCCTTGAAGGCTGTCGATGA |
ORF Protein Sequence | MSDSKCDSQFYSVQVADSTFTVLKRYQQLKPIGSGAQGIVCAAFDTVLGINVAVKKLSRPFQNQTHAKRAYRELVLLKCVNHKNIISLLNVFTPQKTLEEFQDVYLVMELMDANLCQVIHMELDHERMSYLLYQMLCGIKHLHSAGIIHRDLKPSNIVVKSDCTLKILDFGLARTACTNFMMTPYVVTRYYRAPEVILGMGYKENVDIWSVGCIMGELVKGCVIFQGTDHIDQWNKVIEQLGTPSAEFMKKLQPTVRNYVENRPKYPGIKFEELFPDWIFPSESERDKIKTSQARDLLSKMLVIDPDKRISVDEALRHPYITVWYDPAEAEAPPPQIYDAQLEEREHAIEEWKELIYKEVMDWEERSKNGVVKDQPSDAAVSSNATPSQSSSINDISSMSTEQTLASDTDSSLDASTGPLEGCR |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T69375-Ab | Anti-JNK2 monoclonal antibody |
Target Antigen | GM-Tg-g-T69375-Ag | JNK2/MAPK9 protein |
ORF Viral Vector | pGMLP000516 | Human MAPK9 Lentivirus plasmid |
ORF Viral Vector | pGMLP005803 | Human MAPK9 Lentivirus plasmid |
ORF Viral Vector | pGMAP000176 | Human MAPK9 Adenovirus plasmid |
ORF Viral Vector | vGMLP000516 | Human MAPK9 Lentivirus particle |
ORF Viral Vector | vGMLP005803 | Human MAPK9 Lentivirus particle |
ORF Viral Vector | vGMAP000176 | Human MAPK9 Adenovirus particle |
Target information
Target ID | GM-T69375 |
Target Name | JNK2 |
Gene ID | 5601, 26420, 715782, 50658, 101084765, 474652, 534125, 100057961 |
Gene Symbol and Synonyms | JNK-55,JNK2,JNK2A,JNK2ALPHA,JNK2B,JNK2BETA,MAPK9,p54a,p54aSAPK,PRKM9,SAPK,SAPK1a |
Uniprot Accession | P45984 |
Uniprot Entry Name | MK09_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000050748 |
Target Classification | Kinase |
The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase targets specific transcription factors, and thus mediates immediate-early gene expression in response to various cell stimuli. It is most closely related to MAPK8, both of which are involved in UV radiation induced apoptosis, thought to be related to the cytochrome c-mediated cell death pathway. This gene and MAPK8 are also known as c-Jun N-terminal kinases. This kinase blocks the ubiquitination of tumor suppressor p53, and thus it increases the stability of p53 in nonstressed cells. Studies of this gene's mouse counterpart suggest a key role in T-cell differentiation. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Sep 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.