Human MAPK9/JNK-55/JNK2 ORF/cDNA clone-Adenovirus particle (BC032539)

Cat. No.: vGMAP000176

Pre-made Human MAPK9/JNK-55/JNK2 Adenovirus for MAPK9 overexpression in-vitro and in-vivo. The MAPK9 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified MAPK9-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to JNK2/MAPK9/JNK-55 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000176 Human MAPK9 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000176
Gene Name MAPK9
Accession Number BC032539
Gene ID 5601
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1275 bp
Gene Alias JNK-55,JNK2,JNK2A,JNK2ALPHA,JNK2B,JNK2BETA,p54aSAPK
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGAGCGACAGTAAATGTGACAGTCAGTTTTATAGTGTGCAAGTGGCAGACTCAACCTTCACTGTCCTAAAACGTTACCAGCAGCTGAAACCAATTGGCTCTGGGGCCCAAGGGATTGTTTGTGCTGCATTTGATACAGTTCTTGGGATAAATGTTGCAGTCAAGAAACTAAGCCGTCCTTTTCAGAACCAAACTCATGCAAAGAGAGCTTATCGTGAACTTGTCCTCTTAAAATGTGTCAATCATAAAAATATAATTAGTTTGTTAAATGTGTTTACACCACAAAAAACTCTAGAAGAATTTCAAGATGTGTATTTGGTTATGGAATTAATGGATGCTAACTTATGTCAGGTTATTCACATGGAGCTGGATCATGAAAGAATGTCCTACCTTCTTTACCAGATGCTTTGTGGTATTAAACATCTGCATTCAGCTGGTATAATTCATAGAGATTTGAAGCCTAGCAACATTGTTGTGAAATCAGACTGCACCCTGAAGATCCTTGACTTTGGCCTGGCCCGGACAGCGTGCACTAACTTCATGATGACCCCTTACGTGGTGACACGGTACTACCGGGCGCCCGAAGTCATCCTGGGTATGGGCTACAAAGAGAACGTTGATATCTGGTCAGTGGGTTGCATCATGGGAGAGCTGGTGAAAGGTTGTGTGATATTCCAAGGCACTGACCATATTGATCAGTGGAATAAAGTTATTGAGCAGCTGGGAACACCATCAGCAGAGTTCATGAAGAAACTTCAGCCAACTGTGAGGAATTATGTCGAAAACAGACCAAAGTATCCTGGAATCAAATTTGAAGAACTCTTTCCAGATTGGATATTCCCATCAGAATCTGAGCGAGACAAAATAAAAACAAGTCAAGCCAGAGATCTGTTATCAAAAATGTTAGTGATTGATCCTGACAAGCGGATCTCTGTAGACGAAGCTCTGCGTCACCCATACATCACTGTTTGGTATGACCCCGCCGAAGCAGAAGCCCCACCACCTCAAATTTATGATGCCCAGTTGGAAGAAAGAGAACATGCAATTGAAGAATGGAAAGAGCTAATTTACAAAGAAGTCATGGATTGGGAAGAAAGAAGCAAGAATGGTGTTGTAAAAGATCAGCCTTCAGATGCAGCAGTAAGTAGCAACGCCACTCCTTCTCAGTCTTCATCGATCAATGACATTTCATCCATGTCCACTGAGCAGACGCTGGCCTCAGACACAGACAGCAGTCTTGATGCCTCGACGGGACCCCTTGAAGGCTGTCGATGA
ORF Protein Sequence MSDSKCDSQFYSVQVADSTFTVLKRYQQLKPIGSGAQGIVCAAFDTVLGINVAVKKLSRPFQNQTHAKRAYRELVLLKCVNHKNIISLLNVFTPQKTLEEFQDVYLVMELMDANLCQVIHMELDHERMSYLLYQMLCGIKHLHSAGIIHRDLKPSNIVVKSDCTLKILDFGLARTACTNFMMTPYVVTRYYRAPEVILGMGYKENVDIWSVGCIMGELVKGCVIFQGTDHIDQWNKVIEQLGTPSAEFMKKLQPTVRNYVENRPKYPGIKFEELFPDWIFPSESERDKIKTSQARDLLSKMLVIDPDKRISVDEALRHPYITVWYDPAEAEAPPPQIYDAQLEEREHAIEEWKELIYKEVMDWEERSKNGVVKDQPSDAAVSSNATPSQSSSINDISSMSTEQTLASDTDSSLDASTGPLEGCR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T69375-Ab Anti-JNK2 monoclonal antibody
    Target Antigen GM-Tg-g-T69375-Ag JNK2/MAPK9 protein
    ORF Viral Vector pGMLP000516 Human MAPK9 Lentivirus plasmid
    ORF Viral Vector pGMLP005803 Human MAPK9 Lentivirus plasmid
    ORF Viral Vector pGMAP000176 Human MAPK9 Adenovirus plasmid
    ORF Viral Vector vGMLP000516 Human MAPK9 Lentivirus particle
    ORF Viral Vector vGMLP005803 Human MAPK9 Lentivirus particle
    ORF Viral Vector vGMAP000176 Human MAPK9 Adenovirus particle


    Target information

    Target ID GM-T69375
    Target Name JNK2
    Gene ID 5601, 26420, 715782, 50658, 101084765, 474652, 534125, 100057961
    Gene Symbol and Synonyms JNK-55,JNK2,JNK2A,JNK2ALPHA,JNK2B,JNK2BETA,MAPK9,p54a,p54aSAPK,PRKM9,SAPK,SAPK1a
    Uniprot Accession P45984
    Uniprot Entry Name MK09_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000050748
    Target Classification Kinase

    The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase targets specific transcription factors, and thus mediates immediate-early gene expression in response to various cell stimuli. It is most closely related to MAPK8, both of which are involved in UV radiation induced apoptosis, thought to be related to the cytochrome c-mediated cell death pathway. This gene and MAPK8 are also known as c-Jun N-terminal kinases. This kinase blocks the ubiquitination of tumor suppressor p53, and thus it increases the stability of p53 in nonstressed cells. Studies of this gene's mouse counterpart suggest a key role in T-cell differentiation. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Sep 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.