Human PTHLH/HHM/ MGC14611 ORF/cDNA clone-Adenovirus plasmid (BC005961)

Pre-made Human PTHLH/HHM/ MGC14611 adenoviral expression plasmid for PTHLH adenovirus packaging, PTHLH adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to PTHLH/HHM products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000211 Human PTHLH Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000211
Gene Name PTHLH
Accession Number BC005961
Gene ID 5744
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 528 bp
Gene Alias HHM, MGC14611, PLP, PTHR, PTHRP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCAGCGGAGACTGGTTCAGCAGTGGAGCGTCGCGGTGTTCCTGCTGAGCTACGCGGTGCCCTCCTGCGGGCGCTCGGTGGAGGGTCTCAGCCGCCGCCTCAAAAGAGCTGTGTCTGAACATCAGCTCCTCCATGACAAGGGGAAGTCCATCCAAGATTTACGGCGACGATTCTTCCTTCACCATCTGATCGCAGAAATCCACACAGCTGAAATCAGAGCTACCTCGGAGGTGTCCCCTAACTCCAAGCCCTCTCCCAACACAAAGAACCACCCCGTCCGATTTGGGTCTGATGATGAGGGCAGATACCTAACTCAGGAAACTAACAAGGTGGAGACGTACAAAGAGCAGCCGCTCAAGACACCTGGGAAGAAAAAGAAAGGCAAGCCCGGGAAACGCAAGGAGCAGGAAAAGAAAAAACGGCGAACTCGCTCTGCCTGGTTAGACTCTGGAGTGACTGGGAGTGGGCTAGAAGGGGACCACCTGTCTGACACCTCCACAACGTCGCTGGAGCTCGATTCACGGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1230-Ab Anti-PTHR/ PTHLH/ BDE2 functional antibody
    Target Antigen GM-Tg-g-SE1230-Ag PTHLH protein
    ORF Viral Vector pGMLV001901 Human PTHLH Lentivirus plasmid
    ORF Viral Vector pGMLP000529 Human PTHLH Lentivirus plasmid
    ORF Viral Vector pGMAP000211 Human PTHLH Adenovirus plasmid
    ORF Viral Vector vGMLV001901 Human PTHLH Lentivirus particle
    ORF Viral Vector vGMLP000529 Human PTHLH Lentivirus particle
    ORF Viral Vector vGMAP000211 Human PTHLH Adenovirus particle


    Target information

    Target ID GM-SE1230
    Target Name PTHLH
    Gene ID 5744, 19227, 710295, 24695, 554222, 403987, 286767, 100033979
    Gene Symbol and Synonyms BDE2,HHM,PLP,PTH-like,PTHLH,PTHR,PTHRP
    Uniprot Accession P12272
    Uniprot Entry Name PTHR_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Lung cancer
    Gene Ensembl ENSG00000087494
    Target Classification Not Available

    The protein encoded by this gene is a member of the parathyroid hormone family. This hormone, via its receptor, PTHR1, regulates endochondral bone development and epithelial-mesenchymal interactions during the formation of the mammary glands and teeth. It is responsible for most cases of humoral hypercalcemia of malignancy, and mutations in this gene are associated with brachydactyly type E2 (BDE2). Alternatively spliced transcript variants have been found for this gene. There is also evidence for alternative translation initiation from non-AUG (CUG and GUG) start sites, downstream of the initiator AUG codon, resulting in nuclear forms of this hormone. [provided by RefSeq, Nov 2013]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.