Human PTHLH/BDE2/ HHM ORF/cDNA clone-Lentivirus particle (NM_002820)
Pre-made Human PTHLH/BDE2/ HHM Lentiviral expression plasmid for PTHLH lentivirus packaging, PTHLH lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to PTHLH/BDE2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP000529 | Human PTHLH Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP000529 |
Gene Name | PTHLH |
Accession Number | NM_002820 |
Gene ID | 5744 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 528 bp |
Gene Alias | BDE2, HHM, PLP, PTHR, PTHRP |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCAGCGGAGACTGGTTCAGCAGTGGAGCGTCGCGGTGTTCCTGCTGAGCTACGCGGTGCCCTCCTGCGGGCGCTCGGTGGAGGGTCTCAGCCGCCGCCTCAAAAGAGCTGTGTCTGAACATCAGCTCCTCCATGACAAGGGGAAGTCCATCCAAGATTTACGGCGACGATTCTTCCTTCACCATCTGATCGCAGAAATCCACACAGCTGAAATCAGAGCTACCTCGGAGGTGTCCCCTAACTCCAAGCCCTCTCCCAACACAAAGAACCACCCCGTCCGATTTGGGTCTGATGATGAGGGCAGATACCTAACTCAGGAAACTAACAAGGTGGAGACGTACAAAGAGCAGCCGCTCAAGACACCTGGGAAGAAAAAGAAAGGCAAGCCCGGGAAACGCAAGGAGCAGGAAAAGAAAAAACGGCGAACTCGCTCTGCCTGGTTAGACTCTGGAGTGACTGGGAGTGGGCTAGAAGGGGACCACCTGTCTGACACCTCCACAACGTCGCTGGAGCTCGATTCACGGTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1230-Ab | Anti-PTHR/ PTHLH/ BDE2 functional antibody |
Target Antigen | GM-Tg-g-SE1230-Ag | PTHLH protein |
ORF Viral Vector | pGMLV001901 | Human PTHLH Lentivirus plasmid |
ORF Viral Vector | pGMLP000529 | Human PTHLH Lentivirus plasmid |
ORF Viral Vector | pGMAP000211 | Human PTHLH Adenovirus plasmid |
ORF Viral Vector | vGMLV001901 | Human PTHLH Lentivirus particle |
ORF Viral Vector | vGMLP000529 | Human PTHLH Lentivirus particle |
ORF Viral Vector | vGMAP000211 | Human PTHLH Adenovirus particle |
Target information
Target ID | GM-SE1230 |
Target Name | PTHLH |
Gene ID | 5744, 19227, 710295, 24695, 554222, 403987, 286767, 100033979 |
Gene Symbol and Synonyms | BDE2,HHM,PLP,PTH-like,PTHLH,PTHR,PTHRP |
Uniprot Accession | P12272 |
Uniprot Entry Name | PTHR_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Lung cancer |
Gene Ensembl | ENSG00000087494 |
Target Classification | Not Available |
The protein encoded by this gene is a member of the parathyroid hormone family. This hormone, via its receptor, PTHR1, regulates endochondral bone development and epithelial-mesenchymal interactions during the formation of the mammary glands and teeth. It is responsible for most cases of humoral hypercalcemia of malignancy, and mutations in this gene are associated with brachydactyly type E2 (BDE2). Alternatively spliced transcript variants have been found for this gene. There is also evidence for alternative translation initiation from non-AUG (CUG and GUG) start sites, downstream of the initiator AUG codon, resulting in nuclear forms of this hormone. [provided by RefSeq, Nov 2013]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.