Human BSG/5F7/CD147 ORF/cDNA clone-Adenovirus plasmid (BC009040)
Cat. No.: pGMAP000243
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human BSG/5F7/CD147 adenoviral expression plasmid for BSG adenovirus packaging, BSG adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go to
BSG/5F7 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMAP000243 |
| Gene Name | BSG |
| Accession Number | BC009040 |
| Gene ID | 682 |
| Species | Human |
| Product Type | Adenovirus plasmid (overexpression) |
| Insert Length | 810 bp |
| Gene Alias | 5F7,CD147,EMMPRIN,M6,TCSF |
| Fluorescent Reporter | GFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Kanamycin |
| ORF Nucleotide Sequence | ATGGCGGCTGCGCTGTTCGTGCTGCTGGGATTCGCGCTGCTGGGCACCCACGGAGCCTCCGGGGCTGCCGGCACAGTCTTCACTACCGTAGAAGACCTTGGCTCCAAGATACTCCTCACCTGCTCCTTGAATGACAGCGCCACAGAGGTCACAGGGCACCGCTGGCTGAAGGGGGGCGTGGTGCTGAAGGAGGATGCGCTGCCCGGCCAGAAAACGGAGTTCAAGGTGGACTCGGACGACCAGTGGGGAGAGTACTCCTGCGTCTTCCTCCCCGAGCCCATGGGCACGGCCAACATCCAGCTCCACGGGCCTCCCAGAGTGAAGGCTGTGAAGTCGTCAGAACACATCAACGAGGGGGAGACGGCCATGCTGGTCTGCAAGTCAGAGTCCGTGCCACCTGTCACTGACTGGGCCTGGTACAAGATCACTGACTCTGAGGACAAGGCCCTCATGAACGGCTCCGAGAGCAGGTTCTTCGTGAGTTCCTCGCAGGGCCGGTCAGAGCTACACATTGAGAACCTGAACATGGAGGCCGACCCCGGCCAGTACCGGTGCAACGGCACCAGCTCCAAGGGCTCCGACCAGGCCATCATCACGCTCCGCGTGCGCAGCCACCTGGCCGCCCTCTGGCCCTTCCTGGGCATCGTGGCTGAGGTGCTGGTGCTGGTCACCATCATCTTCATCTACGAGAAGCGCCGGAAGCCCGAGGACGTCCTGGATGATGACGACGCCGGCTCTGCACCCCTGAAGAGCAGCGGGCAGCACCAGAATGACAAAGGCAAGAACGTCCGCCAGAGGAACTCTTCCTGA |
| ORF Protein Sequence | MAAALFVLLGFALLGTHGASGAAGTVFTTVEDLGSKILLTCSLNDSATEVTGHRWLKGGVVLKEDALPGQKTEFKVDSDDQWGEYSCVFLPEPMGTANIQLHGPPRVKAVKSSEHINEGETAMLVCKSESVPPVTDWAWYKITDSEDKALMNGSESRFFVSSSQGRSELHIENLNMEADPGQYRCNGTSSKGSDQAIITLRVRSHLAALWPFLGIVAEVLVLVTIIFIYEKRRKPEDVLDDDDAGSAPLKSSGQHQNDKGKNVRQRNSS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Biosimilar | GMP-Bios-INN-1059 | Pre-Made Ziralimumab Biosimilar, Whole Mab, Anti-Bsg Antibody: Anti-5F7/CD147/EMMPRIN/EMPRIN/HAb18G/OK/TCSF therapeutic antibody |
| Biosimilar | GMP-Bios-INN-853 | Pre-Made Gavilimomab Biosimilar, Whole Mab, Anti-Bsg Antibody: Anti-5F7/CD147/EMMPRIN/EMPRIN/HAb18G/OK/TCSF therapeutic antibody |
| Target Antibody | GM-Tg-g-T35040-Ab | Anti-BASI/ BSG/ 5F7 monoclonal antibody |
| Target Antigen | GM-Tg-g-T35040-Ag | BSG VLP (virus-like particle) |
| ORF Viral Vector | pGMLV002088 | Human BSG Lentivirus plasmid |
| ORF Viral Vector | pGMAP000243 | Human BSG Adenovirus plasmid |
| ORF Viral Vector | pGMPC001016 | Human BSG Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLV002088 | Human BSG Lentivirus particle |
| ORF Viral Vector | vGMAP000243 | Human BSG Adenovirus particle |
Target information
| Target ID | GM-T35040 |
| Target Name | BSG |
| Gene ID | 682, 12215, 721068, 25246, 101090746, 476758, 508716, 100049616 |
| Gene Symbol and Synonyms | 5A11,5F7,basignin,BSG,CD147,CE9,EMMPRIN,EMPRIN,HAb18G,HT-7,HT7,OK,Ox47R,RPE7,TCSF |
| Uniprot Accession | P35613 |
| Uniprot Entry Name | BASI_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target, Immuno-oncology Target, INN Index |
| Disease | Urinary bladder urothelial carcinoma |
| Gene Ensembl | ENSG00000172270 |
| Target Classification | Checkpoint-Immuno Oncology |
The protein encoded by this gene, basigin, is a plasma membrane protein that is important in spermatogenesis, embryo implantation, neural network formation, and tumor progression. Basigin is also a member of the immunoglobulin superfamily, ubiquitously expressed in various tissues. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2020]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


