Human BSG/5F7/CD147 ORF/cDNA clone-Adenovirus plasmid (BC009040)

Cat. No.: pGMAP000243
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human BSG/5F7/CD147 adenoviral expression plasmid for BSG adenovirus packaging, BSG adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to BSG/5F7 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP000243
Gene Name BSG
Accession Number BC009040
Gene ID 682
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 810 bp
Gene Alias 5F7,CD147,EMMPRIN,M6,TCSF
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGCGGCTGCGCTGTTCGTGCTGCTGGGATTCGCGCTGCTGGGCACCCACGGAGCCTCCGGGGCTGCCGGCACAGTCTTCACTACCGTAGAAGACCTTGGCTCCAAGATACTCCTCACCTGCTCCTTGAATGACAGCGCCACAGAGGTCACAGGGCACCGCTGGCTGAAGGGGGGCGTGGTGCTGAAGGAGGATGCGCTGCCCGGCCAGAAAACGGAGTTCAAGGTGGACTCGGACGACCAGTGGGGAGAGTACTCCTGCGTCTTCCTCCCCGAGCCCATGGGCACGGCCAACATCCAGCTCCACGGGCCTCCCAGAGTGAAGGCTGTGAAGTCGTCAGAACACATCAACGAGGGGGAGACGGCCATGCTGGTCTGCAAGTCAGAGTCCGTGCCACCTGTCACTGACTGGGCCTGGTACAAGATCACTGACTCTGAGGACAAGGCCCTCATGAACGGCTCCGAGAGCAGGTTCTTCGTGAGTTCCTCGCAGGGCCGGTCAGAGCTACACATTGAGAACCTGAACATGGAGGCCGACCCCGGCCAGTACCGGTGCAACGGCACCAGCTCCAAGGGCTCCGACCAGGCCATCATCACGCTCCGCGTGCGCAGCCACCTGGCCGCCCTCTGGCCCTTCCTGGGCATCGTGGCTGAGGTGCTGGTGCTGGTCACCATCATCTTCATCTACGAGAAGCGCCGGAAGCCCGAGGACGTCCTGGATGATGACGACGCCGGCTCTGCACCCCTGAAGAGCAGCGGGCAGCACCAGAATGACAAAGGCAAGAACGTCCGCCAGAGGAACTCTTCCTGA
ORF Protein Sequence MAAALFVLLGFALLGTHGASGAAGTVFTTVEDLGSKILLTCSLNDSATEVTGHRWLKGGVVLKEDALPGQKTEFKVDSDDQWGEYSCVFLPEPMGTANIQLHGPPRVKAVKSSEHINEGETAMLVCKSESVPPVTDWAWYKITDSEDKALMNGSESRFFVSSSQGRSELHIENLNMEADPGQYRCNGTSSKGSDQAIITLRVRSHLAALWPFLGIVAEVLVLVTIIFIYEKRRKPEDVLDDDDAGSAPLKSSGQHQNDKGKNVRQRNSS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-1059 Pre-Made Ziralimumab Biosimilar, Whole Mab, Anti-Bsg Antibody: Anti-5F7/CD147/EMMPRIN/EMPRIN/HAb18G/OK/TCSF therapeutic antibody
    Biosimilar GMP-Bios-INN-853 Pre-Made Gavilimomab Biosimilar, Whole Mab, Anti-Bsg Antibody: Anti-5F7/CD147/EMMPRIN/EMPRIN/HAb18G/OK/TCSF therapeutic antibody
    Target Antibody GM-Tg-g-T35040-Ab Anti-BASI/ BSG/ 5F7 monoclonal antibody
    Target Antigen GM-Tg-g-T35040-Ag BSG VLP (virus-like particle)
    ORF Viral Vector pGMLV002088 Human BSG Lentivirus plasmid
    ORF Viral Vector pGMAP000243 Human BSG Adenovirus plasmid
    ORF Viral Vector pGMPC001016 Human BSG Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV002088 Human BSG Lentivirus particle
    ORF Viral Vector vGMAP000243 Human BSG Adenovirus particle


    Target information

    Target ID GM-T35040
    Target Name BSG
    Gene ID 682, 12215, 721068, 25246, 101090746, 476758, 508716, 100049616
    Gene Symbol and Synonyms 5A11,5F7,basignin,BSG,CD147,CE9,EMMPRIN,EMPRIN,HAb18G,HT-7,HT7,OK,Ox47R,RPE7,TCSF
    Uniprot Accession P35613
    Uniprot Entry Name BASI_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease Urinary bladder urothelial carcinoma
    Gene Ensembl ENSG00000172270
    Target Classification Checkpoint-Immuno Oncology

    The protein encoded by this gene, basigin, is a plasma membrane protein that is important in spermatogenesis, embryo implantation, neural network formation, and tumor progression. Basigin is also a member of the immunoglobulin superfamily, ubiquitously expressed in various tissues. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2020]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.