Human BSG/5F7/CD147 ORF/cDNA clone-Lentivirus particle (NM_001728.4)
Cat. No.: vGMLV002088
Pre-made Human BSG/5F7/CD147 Lentiviral expression plasmid for BSG lentivirus packaging, BSG lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
BSG/5F7 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLV002088 | Human BSG Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLV002088 |
Gene Name | BSG |
Accession Number | NM_001728.4 |
Gene ID | 682 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1158 bp |
Gene Alias | 5F7,CD147,EMMPRIN,EMPRIN,HAb18G,OK,TCSF |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | Null |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCGGCTGCGCTGTTCGTGCTGCTGGGATTCGCGCTGCTGGGCACCCACGGAGCCTCCGGGGCTGCCGGCTTCGTCCAGGCGCCGCTGTCCCAGCAGAGGTGGGTGGGGGGCAGTGTGGAGCTGCACTGCGAGGCCGTGGGCAGCCCGGTGCCCGAGATCCAGTGGTGGTTTGAAGGGCAGGGTCCCAACGACACCTGCTCCCAGCTCTGGGACGGCGCCCGGCTGGACCGCGTCCACATCCACGCCACCTACCACCAGCACGCGGCCAGCACCATCTCCATCGACACGCTCGTGGAGGAGGACACGGGCACTTACGAGTGCCGGGCCAGCAACGACCCGGATCGCAACCACCTGACCCGGGCGCCCAGGGTCAAGTGGGTCCGCGCCCAGGCAGTCGTGCTAGTCCTGGAACCCGGCACAGTCTTCACTACCGTAGAAGACCTTGGCTCCAAGATACTCCTCACCTGCTCCTTGAATGACAGCGCCACAGAGGTCACAGGGCACCGCTGGCTGAAGGGGGGCGTGGTGCTGAAGGAGGACGCGCTGCCCGGCCAGAAAACGGAGTTCAAGGTGGACTCCGACGACCAGTGGGGAGAGTACTCCTGCGTCTTCCTCCCCGAGCCCATGGGCACGGCCAACATCCAGCTCCACGGGCCTCCCAGAGTGAAGGCTGTGAAGTCGTCAGAACACATCAACGAGGGGGAGACGGCCATGCTGGTCTGCAAGTCAGAGTCCGTGCCACCTGTCACTGACTGGGCCTGGTACAAGATCACTGACTCTGAGGACAAGGCCCTCATGAACGGCTCCGAGAGCAGGTTCTTCGTGAGTTCCTCGCAGGGCCGGTCAGAGCTACACATTGAGAACCTGAACATGGAGGCCGACCCCGGCCAGTACCGGTGCAACGGCACCAGCTCCAAGGGCTCCGACCAGGCCATCATCACGCTCCGCGTGCGCAGCCACCTGGCCGCCCTCTGGCCCTTCCTGGGCATCGTGGCTGAGGTGCTGGTGCTGGTCACCATCATCTTCATCTACGAGAAGCGCCGGAAGCCCGAGGACGTCCTGGATGATGACGACGCCGGCTCTGCACCCCTGAAGAGCAGCGGGCAGCACCAGAATGACAAAGGCAAGAACGTCCGCCAGAGGAACTCTTCCTGA |
ORF Protein Sequence | MAAALFVLLGFALLGTHGASGAAGFVQAPLSQQRWVGGSVELHCEAVGSPVPEIQWWFEGQGPNDTCSQLWDGARLDRVHIHATYHQHAASTISIDTLVEEDTGTYECRASNDPDRNHLTRAPRVKWVRAQAVVLVLEPGTVFTTVEDLGSKILLTCSLNDSATEVTGHRWLKGGVVLKEDALPGQKTEFKVDSDDQWGEYSCVFLPEPMGTANIQLHGPPRVKAVKSSEHINEGETAMLVCKSESVPPVTDWAWYKITDSEDKALMNGSESRFFVSSSQGRSELHIENLNMEADPGQYRCNGTSSKGSDQAIITLRVRSHLAALWPFLGIVAEVLVLVTIIFIYEKRRKPEDVLDDDDAGSAPLKSSGQHQNDKGKNVRQRNSS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-INN-1059 | Pre-Made Ziralimumab Biosimilar, Whole Mab, Anti-Bsg Antibody: Anti-5F7/CD147/EMMPRIN/EMPRIN/HAb18G/OK/TCSF therapeutic antibody |
Biosimilar | GMP-Bios-INN-853 | Pre-Made Gavilimomab Biosimilar, Whole Mab, Anti-Bsg Antibody: Anti-5F7/CD147/EMMPRIN/EMPRIN/HAb18G/OK/TCSF therapeutic antibody |
Target Antibody | GM-Tg-g-T35040-Ab | Anti-BASI/ BSG/ 5F7 monoclonal antibody |
Target Antigen | GM-Tg-g-T35040-Ag | BSG VLP (virus-like particle) |
ORF Viral Vector | pGMLV002088 | Human BSG Lentivirus plasmid |
ORF Viral Vector | pGMAP000243 | Human BSG Adenovirus plasmid |
ORF Viral Vector | pGMPC001016 | Human BSG Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLV002088 | Human BSG Lentivirus particle |
ORF Viral Vector | vGMAP000243 | Human BSG Adenovirus particle |
Target information
Target ID | GM-T35040 |
Target Name | BSG |
Gene ID | 682, 12215, 721068, 25246, 101090746, 476758, 508716, 100049616 |
Gene Symbol and Synonyms | 5A11,5F7,basignin,BSG,CD147,CE9,EMMPRIN,EMPRIN,HAb18G,HT-7,HT7,OK,Ox47R,RPE7,TCSF |
Uniprot Accession | P35613 |
Uniprot Entry Name | BASI_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target, INN Index |
Disease | Urinary bladder urothelial carcinoma |
Gene Ensembl | ENSG00000172270 |
Target Classification | Checkpoint-Immuno Oncology |
The protein encoded by this gene, basigin, is a plasma membrane protein that is important in spermatogenesis, embryo implantation, neural network formation, and tumor progression. Basigin is also a member of the immunoglobulin superfamily, ubiquitously expressed in various tissues. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.