Click here to discover the largest collection of GeneMedi's Promise-ORF™ ORF/cDNA expression clones
- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
TECHNICAL RESOURCE
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human BSG/5F7/CD147 ORF/cDNA clone-Adenovirus particle (BC009040)
Cat. No.: vGMAP000243
Pre-made Human BSG/5F7/CD147 Adenovirus for BSG overexpression in-vitro and in-vivo. The BSG adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified BSG-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
BSG/5F7 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
MSDS
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP000243 | Human BSG Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP000243 |
| Gene Name | BSG |
| Accession Number | BC009040 |
| Gene ID | 682 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 810 bp |
| Gene Alias | 5F7,CD147,EMMPRIN,M6,TCSF |
| Fluorescent Reporter | GFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Kanamycin |
| ORF Nucleotide Sequence | ATGGCGGCTGCGCTGTTCGTGCTGCTGGGATTCGCGCTGCTGGGCACCCACGGAGCCTCCGGGGCTGCCGGCACAGTCTTCACTACCGTAGAAGACCTTGGCTCCAAGATACTCCTCACCTGCTCCTTGAATGACAGCGCCACAGAGGTCACAGGGCACCGCTGGCTGAAGGGGGGCGTGGTGCTGAAGGAGGATGCGCTGCCCGGCCAGAAAACGGAGTTCAAGGTGGACTCGGACGACCAGTGGGGAGAGTACTCCTGCGTCTTCCTCCCCGAGCCCATGGGCACGGCCAACATCCAGCTCCACGGGCCTCCCAGAGTGAAGGCTGTGAAGTCGTCAGAACACATCAACGAGGGGGAGACGGCCATGCTGGTCTGCAAGTCAGAGTCCGTGCCACCTGTCACTGACTGGGCCTGGTACAAGATCACTGACTCTGAGGACAAGGCCCTCATGAACGGCTCCGAGAGCAGGTTCTTCGTGAGTTCCTCGCAGGGCCGGTCAGAGCTACACATTGAGAACCTGAACATGGAGGCCGACCCCGGCCAGTACCGGTGCAACGGCACCAGCTCCAAGGGCTCCGACCAGGCCATCATCACGCTCCGCGTGCGCAGCCACCTGGCCGCCCTCTGGCCCTTCCTGGGCATCGTGGCTGAGGTGCTGGTGCTGGTCACCATCATCTTCATCTACGAGAAGCGCCGGAAGCCCGAGGACGTCCTGGATGATGACGACGCCGGCTCTGCACCCCTGAAGAGCAGCGGGCAGCACCAGAATGACAAAGGCAAGAACGTCCGCCAGAGGAACTCTTCCTGA |
| ORF Protein Sequence | MAAALFVLLGFALLGTHGASGAAGTVFTTVEDLGSKILLTCSLNDSATEVTGHRWLKGGVVLKEDALPGQKTEFKVDSDDQWGEYSCVFLPEPMGTANIQLHGPPRVKAVKSSEHINEGETAMLVCKSESVPPVTDWAWYKITDSEDKALMNGSESRFFVSSSQGRSELHIENLNMEADPGQYRCNGTSSKGSDQAIITLRVRSHLAALWPFLGIVAEVLVLVTIIFIYEKRRKPEDVLDDDDAGSAPLKSSGQHQNDKGKNVRQRNSS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Biosimilar | GMP-Bios-INN-1059 | Pre-Made Ziralimumab Biosimilar, Whole Mab, Anti-Bsg Antibody: Anti-5F7/CD147/EMMPRIN/EMPRIN/HAb18G/OK/TCSF therapeutic antibody |
| Biosimilar | GMP-Bios-INN-853 | Pre-Made Gavilimomab Biosimilar, Whole Mab, Anti-Bsg Antibody: Anti-5F7/CD147/EMMPRIN/EMPRIN/HAb18G/OK/TCSF therapeutic antibody |
| Target Antibody | GM-Tg-g-T35040-Ab | Anti-BASI/ BSG/ 5F7 monoclonal antibody |
| Target Antigen | GM-Tg-g-T35040-Ag | BSG VLP (virus-like particle) |
| ORF Viral Vector | pGMLV002088 | Human BSG Lentivirus plasmid |
| ORF Viral Vector | pGMAP000243 | Human BSG Adenovirus plasmid |
| ORF Viral Vector | pGMPC001016 | Human BSG Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLV002088 | Human BSG Lentivirus particle |
| ORF Viral Vector | vGMAP000243 | Human BSG Adenovirus particle |
Target information
| Target ID | GM-T35040 |
| Target Name | BSG |
| Gene ID | 682, 12215, 721068, 25246, 101090746, 476758, 508716, 100049616 |
| Gene Symbol and Synonyms | 5A11,5F7,basignin,BSG,CD147,CE9,EMMPRIN,EMPRIN,HAb18G,HT-7,HT7,OK,Ox47R,RPE7,TCSF |
| Uniprot Accession | P35613 |
| Uniprot Entry Name | BASI_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target, Immuno-oncology Target, INN Index |
| Disease | Urinary bladder urothelial carcinoma |
| Gene Ensembl | ENSG00000172270 |
| Target Classification | Checkpoint-Immuno Oncology |
The protein encoded by this gene, basigin, is a plasma membrane protein that is important in spermatogenesis, embryo implantation, neural network formation, and tumor progression. Basigin is also a member of the immunoglobulin superfamily, ubiquitously expressed in various tissues. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
