Human PLA2G2A/MOM1/ PLA2 ORF/cDNA clone-Adenovirus plasmid (BC005919)
Pre-made Human PLA2G2A/MOM1/ PLA2 adenoviral expression plasmid for PLA2G2A adenovirus packaging, PLA2G2A adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to GIIA sPLA2/PLA2G2A/MOM1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAP000318 | Human PLA2G2A Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAP000318 |
Gene Name | PLA2G2A |
Accession Number | BC005919 |
Gene ID | 5320 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 435 bp |
Gene Alias | MOM1, PLA2, PLA2S, PLAS1, sPLA2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAAGACCCTCCTACTGTTGGCAGTGATCATGATCTTTGGCCTACTGCAGGCCCATGGGAATTTGGTGAATTTCCACAGAATGATCAAGTTGACGACAGGAAAGGAAGCCGCACTCAGTTATGGCTTCTACGGCTGCCACTGTGGCGTGGGTGGCAGAGGATCCCCCAAGGATGCAACGGATCGCTGCTGTGTCACTCATGACTGTTGCTACAAACGTCTGGAGAAACGTGGATGTGGCACCAAATTTCTGAGCTACAAGTTTAGCAACTCGGGGAGCAGAATCACCTGTGCAAAACAGGACTCCTGCAGAAGTCAACTGTGTGAGTGTGATAAGGCTGCTGCCACCTGTTTTGCTAGAAACAAGACGACCTACAATAAAAAGTACCAGTACTATTCCAATAAACACTGCAGAGGGAGCACCCCTCGTTGCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T19160-Ab | Anti-PA2GA/ GIIA sPLA2/ PLA2G2A monoclonal antibody |
Target Antigen | GM-Tg-g-T19160-Ag | GIIA sPLA2/PLA2G2A VLP (virus-like particle) |
ORF Viral Vector | pGMAP000318 | Human PLA2G2A Adenovirus plasmid |
ORF Viral Vector | vGMAP000318 | Human PLA2G2A Adenovirus particle |
Target information
Target ID | GM-T19160 |
Target Name | GIIA sPLA2 |
Gene ID | 5320, 18780, 704520, 29692, 100037401 |
Gene Symbol and Synonyms | EF,MOM1,PLA2,PLA2B,PLA2G2A,PLA2L,PLA2S,PLAS1,sPLA2,sPla2-IIA |
Uniprot Accession | P14555 |
Uniprot Entry Name | PA2GA_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Prostate Cancer |
Gene Ensembl | ENSG00000188257 |
Target Classification | Not Available |
The protein encoded by this gene is a member of the phospholipase A2 family (PLA2). PLA2s constitute a diverse family of enzymes with respect to sequence, function, localization, and divalent cation requirements. This gene product belongs to group II, which contains secreted form of PLA2, an extracellular enzyme that has a low molecular mass and requires calcium ions for catalysis. It catalyzes the hydrolysis of the sn-2 fatty acid acyl ester bond of phosphoglycerides, releasing free fatty acids and lysophospholipids, and thought to participate in the regulation of the phospholipid metabolism in biomembranes. Several alternatively spliced transcript variants with different 5' UTRs have been found for this gene.[provided by RefSeq, Sep 2009]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.