Human PLA2G2A/MOM1/ PLA2 ORF/cDNA clone-Adenovirus particle (BC005919)

Pre-made Human PLA2G2A/MOM1/ PLA2 Adenovirus for PLA2G2A overexpression in-vitro and in-vivo. The PLA2G2A adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified PLA2G2A-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to GIIA sPLA2/PLA2G2A/MOM1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000318 Human PLA2G2A Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000318
Gene Name PLA2G2A
Accession Number BC005919
Gene ID 5320
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 435 bp
Gene Alias MOM1, PLA2, PLA2S, PLAS1, sPLA2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAGACCCTCCTACTGTTGGCAGTGATCATGATCTTTGGCCTACTGCAGGCCCATGGGAATTTGGTGAATTTCCACAGAATGATCAAGTTGACGACAGGAAAGGAAGCCGCACTCAGTTATGGCTTCTACGGCTGCCACTGTGGCGTGGGTGGCAGAGGATCCCCCAAGGATGCAACGGATCGCTGCTGTGTCACTCATGACTGTTGCTACAAACGTCTGGAGAAACGTGGATGTGGCACCAAATTTCTGAGCTACAAGTTTAGCAACTCGGGGAGCAGAATCACCTGTGCAAAACAGGACTCCTGCAGAAGTCAACTGTGTGAGTGTGATAAGGCTGCTGCCACCTGTTTTGCTAGAAACAAGACGACCTACAATAAAAAGTACCAGTACTATTCCAATAAACACTGCAGAGGGAGCACCCCTCGTTGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T19160-Ab Anti-PA2GA/ GIIA sPLA2/ PLA2G2A monoclonal antibody
    Target Antigen GM-Tg-g-T19160-Ag GIIA sPLA2/PLA2G2A VLP (virus-like particle)
    ORF Viral Vector pGMAP000318 Human PLA2G2A Adenovirus plasmid
    ORF Viral Vector vGMAP000318 Human PLA2G2A Adenovirus particle


    Target information

    Target ID GM-T19160
    Target Name GIIA sPLA2
    Gene ID 5320, 18780, 704520, 29692, 100037401
    Gene Symbol and Synonyms EF,MOM1,PLA2,PLA2B,PLA2G2A,PLA2L,PLA2S,PLAS1,sPLA2,sPla2-IIA
    Uniprot Accession P14555
    Uniprot Entry Name PA2GA_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Prostate Cancer
    Gene Ensembl ENSG00000188257
    Target Classification Not Available

    The protein encoded by this gene is a member of the phospholipase A2 family (PLA2). PLA2s constitute a diverse family of enzymes with respect to sequence, function, localization, and divalent cation requirements. This gene product belongs to group II, which contains secreted form of PLA2, an extracellular enzyme that has a low molecular mass and requires calcium ions for catalysis. It catalyzes the hydrolysis of the sn-2 fatty acid acyl ester bond of phosphoglycerides, releasing free fatty acids and lysophospholipids, and thought to participate in the regulation of the phospholipid metabolism in biomembranes. Several alternatively spliced transcript variants with different 5' UTRs have been found for this gene.[provided by RefSeq, Sep 2009]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.