Human CNTF/HCNTF ORF/cDNA clone-Adenovirus plasmid (BC068030)

Pre-made Human CNTF/HCNTF adenoviral expression plasmid for CNTF adenovirus packaging, CNTF adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to CNTF/HCNTF products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000377 Human CNTF Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000377
Gene Name CNTF
Accession Number BC068030
Gene ID 1270
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 603 bp
Gene Alias HCNTF
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCTTTCACAGAGCATTCACCGCTGACCCCTCACCGTCGGGACCTCTGTAGCCGCTCTATCTGGCTAGCAAGGAAGATTCGTTCAGACCTGACTGCTCTTACGGAATCCTATGTGAAGCATCAGGGCCTGAACAAGAACATCAACCTGGACTCTGCGGATGGGATGCCAGTGGCAAGCACTGATCAGTGGAGTGAGCTGACCGAGGCAGAGCGACTCCAAGAGAACCTTCAAGCTTATCGTACCTTCCATGTTTTGTTGGCCAGGCTCTTAGAAGACCAGCAGGTGCATTTTACCCCAACCGAAGGTGACTTCCATCAAGCTATACATACCCTTCTTCTCCAAGTCGCTGCCTTTGCATACCAGATAGAGGAGTTAATGATACTCCTGGAATACAAGATCCCCCGCAATGAGGCTGATGGGATGCCTATTAATGTTGGAGATGGTGGTCTCTTTGAGAAGAAGCTGTGGGGCCTAAAGGTGCTGCAGGAGCTTTCACAGTGGACAGTAAGGTCCATCCATGACCTTCGTTTCATTTCTTCTCATCAGACTGGGATCCCAGCACGTGGGAGCCATTATATTGCTAACAACAAGAAAATGTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T83192-Ab Anti-CNTF monoclonal antibody
    Target Antigen GM-Tg-g-T83192-Ag CNTF protein
    Cytokine cks-Tg-g-GM-T83192 ciliary neurotrophic factor (CNTF) protein & antibody
    ORF Viral Vector pGMLV000127 Rat Cntf Lentivirus plasmid
    ORF Viral Vector pGMLP000479 Human CNTF Lentivirus plasmid
    ORF Viral Vector pGMAP000377 Human CNTF Adenovirus plasmid
    ORF Viral Vector vGMLV000127 Rat Cntf Lentivirus particle
    ORF Viral Vector vGMLP000479 Human CNTF Lentivirus particle
    ORF Viral Vector vGMAP000377 Human CNTF Adenovirus particle


    Target information

    Target ID GM-T83192
    Target Name CNTF
    Gene ID 1270, 12803, 701907, 25707, 101097592, 483464, 100848228, 100629778
    Gene Symbol and Synonyms CNTF,HCNTF
    Uniprot Accession P26441
    Uniprot Entry Name CNTF_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000242689
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene is a polypeptide hormone whose actions appear to be restricted to the nervous system where it promotes neurotransmitter synthesis and neurite outgrowth in certain neuronal populations. The protein is a potent survival factor for neurons and oligodendrocytes and may be relevant in reducing tissue destruction during inflammatory attacks. A mutation in this gene, which results in aberrant splicing, leads to ciliary neurotrophic factor deficiency, but this phenotype is not causally related to neurologic disease. A read-through transcript variant composed of the upstream ZFP91 gene and CNTF sequence has been identified, but it is thought to be non-coding. Read-through transcription of ZFP91 and CNTF has also been observed in mouse. [provided by RefSeq, Oct 2010]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.