Human CNTF/HCNTF ORF/cDNA clone-Lentivirus particle (NM_000614)
Pre-made Human CNTF/HCNTF Lentiviral expression plasmid for CNTF lentivirus packaging, CNTF lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to CNTF/HCNTF products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP000479 | Human CNTF Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP000479 |
Gene Name | CNTF |
Accession Number | NM_000614 |
Gene ID | 1270 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 603 bp |
Gene Alias | HCNTF |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCTTTCACAGAGCATTCACCGCTGACCCCTCACCGTCGGGACCTCTGTAGCCGCTCTATCTGGCTAGCAAGGAAGATTCGTTCAGACCTGACTGCTCTTACGGAATCCTATGTGAAGCATCAGGGCCTGAACAAGAACATCAACCTGGACTCTGCGGATGGGATGCCAGTGGCAAGCACTGATCAGTGGAGTGAGCTGACCGAGGCAGAGCGACTCCAAGAGAACCTTCAAGCTTATCGTACCTTCCATGTTTTGTTGGCCAGGCTCTTAGAAGACCAGCAGGTGCATTTTACCCCAACCGAAGGTGACTTCCATCAAGCTATACATACCCTTCTTCTCCAAGTCGCTGCCTTTGCATACCAGATAGAGGAGTTAATGATACTCCTGGAATACAAGATCCCCCGCAATGAGGCTGATGGGATGCCTATTAATGTTGGAGATGGTGGTCTCTTTGAGAAGAAGCTGTGGGGCCTAAAGGTGCTGCAGGAGCTTTCACAGTGGACAGTAAGGTCCATCCATGACCTTCGTTTCATTTCTTCTCATCAGACTGGGATCCCAGCACGTGGGAGCCATTATATTGCTAACAACAAGAAAATGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T83192-Ab | Anti-CNTF monoclonal antibody |
Target Antigen | GM-Tg-g-T83192-Ag | CNTF protein |
Cytokine | cks-Tg-g-GM-T83192 | ciliary neurotrophic factor (CNTF) protein & antibody |
ORF Viral Vector | pGMLV000127 | Rat Cntf Lentivirus plasmid |
ORF Viral Vector | pGMLP000479 | Human CNTF Lentivirus plasmid |
ORF Viral Vector | pGMAP000377 | Human CNTF Adenovirus plasmid |
ORF Viral Vector | vGMLV000127 | Rat Cntf Lentivirus particle |
ORF Viral Vector | vGMLP000479 | Human CNTF Lentivirus particle |
ORF Viral Vector | vGMAP000377 | Human CNTF Adenovirus particle |
Target information
Target ID | GM-T83192 |
Target Name | CNTF |
Gene ID | 1270, 12803, 701907, 25707, 101097592, 483464, 100848228, 100629778 |
Gene Symbol and Synonyms | CNTF,HCNTF |
Uniprot Accession | P26441 |
Uniprot Entry Name | CNTF_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target, Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000242689 |
Target Classification | Tumor-associated antigen (TAA) |
The protein encoded by this gene is a polypeptide hormone whose actions appear to be restricted to the nervous system where it promotes neurotransmitter synthesis and neurite outgrowth in certain neuronal populations. The protein is a potent survival factor for neurons and oligodendrocytes and may be relevant in reducing tissue destruction during inflammatory attacks. A mutation in this gene, which results in aberrant splicing, leads to ciliary neurotrophic factor deficiency, but this phenotype is not causally related to neurologic disease. A read-through transcript variant composed of the upstream ZFP91 gene and CNTF sequence has been identified, but it is thought to be non-coding. Read-through transcription of ZFP91 and CNTF has also been observed in mouse. [provided by RefSeq, Oct 2010]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.