Human TXNIP/ARRDC6/ EST01027 ORF/cDNA clone-Adenovirus plasmid (NM_006472.5)

Pre-made Human TXNIP/ARRDC6/ EST01027 adenoviral expression plasmid for TXNIP adenovirus packaging, TXNIP adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to VDUP1/TXNIP/ARRDC6 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000591 Human TXNIP Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000591
Gene Name TXNIP
Accession Number NM_006472.5
Gene ID 10628
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 1176 bp
Gene Alias ARRDC6, EST01027, HHCPA78, THIF, VDUP1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGTGATGTTCAAGAAGATCAAGTCTTTTGAGGTGGTCTTTAACGACCCTGAAAAGGTGTACGGCAGTGGCGAGAAGGTGGCTGGCCGGGTGATAGTGGAGGTGTGTGAAGTTACTCGTGTCAAAGCCGTTAGGATCCTGGCTTGCGGAGTGGCTAAAGTGCTTTGGATGCAGGGATCCCAGCAGTGCAAACAGACTTCGGAGTACCTGCGCTATGAAGACACGCTTCTTCTGGAAGACCAGCCAACAGGTGAGAATGAGATGGTGATCATGAGACCTGGAAACAAATATGAGTACAAGTTCGGCTTTGAGCTTCCTCAGGGGCCTCTGGGAACATCCTTCAAAGGAAAATATGGGTGTGTAGACTACTGGGTGAAGGCTTTTCTTGACCGCCCGAGCCAGCCAACTCAAGAGACAAAGAAAAACTTTGAAGTAGTGGATCTGGTGGATGTCAATACCCCTGATTTAATGGCACCTGTGTCTGCTAAAAAAGAAAAGAAAGTTTCCTGCATGTTCATTCCTGATGGGCGGGTGTCTGTCTCTGCTCGAATTGACAGAAAAGGATTCTGTGAAGGTGATGAGATTTCCATCCATGCTGACTTTGAGAATACATGTTCCCGAATTGTGGTCCCCAAAGCTGCCATTGTGGCCCGCCACACTTACCTTGCCAATGGCCAGACCAAGGTGCTGACTCAGAAGTTGTCATCAGTCAGAGGCAATCATATTATCTCAGGGACATGCGCATCATGGCGTGGCAAGAGCCTTCGGGTTCAGAAGATCAGGCCTTCTATCCTGGGCTGCAACATCCTTCGAGTTGAATATTCCTTACTGATCTATGTTAGCGTTCCTGGATCCAAGAAGGTCATCCTTGACCTGCCCCTGGTAATTGGCAGCAGATCAGGTCTAAGCAGCAGAACATCCAGCATGGCCAGCCGAACCAGCTCTGAGATGAGTTGGGTAGATCTGAACATCCCTGATACCCCAGAAGCTCCTCCCTGCTATATGGATGTCATTCCTGAAGATCACCGATTGGAGAGCCCAACCACTCCTCTGCTAGATGACATGGATGGCTCTCAAGACAGCCCTATCTTTATGTATGCCCCTGAGTTCAAGTTCATGCCACCACCGACTTATACTGAGGTGGATCCCTGCATCCTCAACAACAATGTGCAGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0163-Ab Anti-VDUP1 monoclonal antibody
    Target Antigen GM-Tg-g-IP0163-Ag VDUP1/TXNIP protein
    ORF Viral Vector pGMLV000188 Human TXNIP Lentivirus plasmid
    ORF Viral Vector pGMLV001158 Human TXNIP Lentivirus plasmid
    ORF Viral Vector pGMAAV000569 Rat Txnip Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV000593 Rat Txnip Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMPC000243 Human TXNIP Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001146 Human TXNIP Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMAP000591 Human TXNIP Adenovirus plasmid
    ORF Viral Vector vGMLV000188 Human TXNIP Lentivirus particle
    ORF Viral Vector vGMLV001158 Human TXNIP Lentivirus particle
    ORF Viral Vector vGMAAV000569 Rat Txnip Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV000593 Rat Txnip Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAP000591 Human TXNIP Adenovirus particle


    Target information

    Target ID GM-IP0163
    Target Name VDUP1
    Gene ID 10628, 56338, 698683, 117514, 101099739, 475829, 506790, 111773538
    Gene Symbol and Synonyms 1200008J08Rik,ARRDC6,EST01027,HHCPA78,Hyplip1,Tbp-2,THIF,TXNIP,VDUP1
    Uniprot Accession Q9H3M7
    Uniprot Entry Name TXNIP_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000265972
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a thioredoxin-binding protein that is a member of the alpha arrestin protein family. Thioredoxin is a thiol-oxidoreductase that is a major regulator of cellular redox signaling which protects cells from oxidative stress. This protein inhibits the antioxidative function of thioredoxin resulting in the accumulation of reactive oxygen species and cellular stress. This protein also functions as a regulator of cellular metabolism and of endoplasmic reticulum (ER) stress. This protein may also function as a tumor suppressor. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.