Human TXNIP/ARRDC6/ EST01027 ORF/cDNA clone-Lentivirus plasmid (NM_006472.6)
Pre-made Human TXNIP/ARRDC6/ EST01027 Lentiviral expression plasmid for TXNIP lentivirus packaging, TXNIP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to VDUP1/TXNIP/ARRDC6 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLV001158 | Human TXNIP Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLV001158 |
Gene Name | TXNIP |
Accession Number | NM_006472.6 |
Gene ID | 10628 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1176 bp |
Gene Alias | ARRDC6, EST01027, HHCPA78, THIF, VDUP1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocinmyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGTGATGTTCAAGAAGATCAAGTCTTTTGAGGTGGTCTTTAACGACCCTGAAAAGGTGTACGGCAGTGGCGAGAAGGTGGCTGGCCGGGTGATAGTGGAGGTGTGTGAAGTTACTCGTGTCAAAGCCGTTAGGATCCTGGCTTGCGGAGTGGCTAAAGTGCTTTGGATGCAGGGATCCCAGCAGTGCAAACAGACTTCGGAGTACCTGCGCTATGAAGACACGCTTCTTCTGGAAGACCAGCCAACAGGTGAGAATGAGATGGTGATCATGAGACCTGGAAACAAATATGAGTACAAGTTCGGCTTTGAGCTTCCTCAGGGGCCTCTGGGAACATCCTTCAAAGGAAAATATGGGTGTGTAGACTACTGGGTGAAGGCTTTTCTTGACCGCCCGAGCCAGCCAACTCAAGAGACAAAGAAAAACTTTGAAGTAGTGGATCTGGTGGATGTCAATACCCCTGATTTAATGGCACCTGTGTCTGCTAAAAAAGAAAAGAAAGTTTCCTGCATGTTCATTCCTGATGGGCGGGTGTCTGTCTCTGCTCGAATTGACAGAAAAGGATTCTGTGAAGGTGATGAGATTTCCATCCATGCTGACTTTGAGAATACATGTTCCCGAATTGTGGTCCCCAAAGCTGCCATTGTGGCCCGCCACACTTACCTTGCCAATGGCCAGACCAAGGTGCTGACTCAGAAGTTGTCATCAGTCAGAGGCAATCATATTATCTCAGGGACATGCGCATCATGGCGTGGCAAGAGCCTTCGGGTTCAGAAGATCAGGCCTTCTATCCTGGGCTGCAACATCCTTCGAGTTGAATATTCCTTACTGATCTATGTTAGCGTTCCTGGATCCAAGAAGGTCATCCTTGACCTGCCCCTGGTAATTGGCAGCAGATCAGGTCTAAGCAGCAGAACATCCAGCATGGCCAGCCGAACCAGCTCTGAGATGAGTTGGGTAGATCTGAACATCCCTGATACCCCAGAAGCTCCTCCCTGCTATATGGATGTCATTCCTGAAGATCACCGATTGGAGAGCCCAACCACTCCTCTGCTAGATGACATGGATGGCTCTCAAGACAGCCCTATCTTTATGTATGCCCCTGAGTTCAAGTTCATGCCACCACCGACTTATACTGAGGTGGATCCCTGCATCCTCAACAACAATGTGCAGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0163-Ab | Anti-VDUP1 monoclonal antibody |
Target Antigen | GM-Tg-g-IP0163-Ag | VDUP1/TXNIP protein |
ORF Viral Vector | pGMLV000188 | Human TXNIP Lentivirus plasmid |
ORF Viral Vector | pGMLV001158 | Human TXNIP Lentivirus plasmid |
ORF Viral Vector | pGMAAV000569 | Rat Txnip Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMAAV000593 | Rat Txnip Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMPC000243 | Human TXNIP Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC001146 | Human TXNIP Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMAP000591 | Human TXNIP Adenovirus plasmid |
ORF Viral Vector | vGMLV000188 | Human TXNIP Lentivirus particle |
ORF Viral Vector | vGMLV001158 | Human TXNIP Lentivirus particle |
ORF Viral Vector | vGMAAV000569 | Rat Txnip Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAAV000593 | Rat Txnip Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAP000591 | Human TXNIP Adenovirus particle |
Target information
Target ID | GM-IP0163 |
Target Name | VDUP1 |
Gene ID | 10628, 56338, 698683, 117514, 101099739, 475829, 506790, 111773538 |
Gene Symbol and Synonyms | 1200008J08Rik,ARRDC6,EST01027,HHCPA78,Hyplip1,Tbp-2,THIF,TXNIP,VDUP1 |
Uniprot Accession | Q9H3M7 |
Uniprot Entry Name | TXNIP_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000265972 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a thioredoxin-binding protein that is a member of the alpha arrestin protein family. Thioredoxin is a thiol-oxidoreductase that is a major regulator of cellular redox signaling which protects cells from oxidative stress. This protein inhibits the antioxidative function of thioredoxin resulting in the accumulation of reactive oxygen species and cellular stress. This protein also functions as a regulator of cellular metabolism and of endoplasmic reticulum (ER) stress. This protein may also function as a tumor suppressor. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.