Human TXNIP/ARRDC6/EST01027 ORF/cDNA clone-Lentivirus plasmid (NM_006472.5)

Cat. No.: pGMLV000188
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TXNIP/ARRDC6/EST01027 Lentiviral expression plasmid for TXNIP lentivirus packaging, TXNIP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to VDUP1/TXNIP/ARRDC6 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $629.28
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV000188
Gene Name TXNIP
Accession Number NM_006472.5
Gene ID 10628
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1176 bp
Gene Alias ARRDC6,EST01027,HHCPA78,THIF,VDUP1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag Null
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGTGATGTTCAAGAAGATCAAGTCTTTTGAGGTGGTCTTTAACGACCCTGAAAAGGTGTACGGCAGTGGCGAGAAGGTGGCTGGCCGGGTGATAGTGGAGGTGTGTGAAGTTACTCGTGTCAAAGCCGTTAGGATCCTGGCTTGCGGAGTGGCTAAAGTGCTTTGGATGCAGGGATCCCAGCAGTGCAAACAGACTTCGGAGTACCTGCGCTATGAAGACACGCTTCTTCTGGAAGACCAGCCAACAGGTGAGAATGAGATGGTGATCATGAGACCTGGAAACAAATATGAGTACAAGTTCGGCTTTGAGCTTCCTCAGGGGCCTCTGGGAACATCCTTCAAAGGAAAATATGGGTGTGTAGACTACTGGGTGAAGGCTTTTCTTGACCGCCCGAGCCAGCCAACTCAAGAGACAAAGAAAAACTTTGAAGTAGTGGATCTGGTGGATGTCAATACCCCTGATTTAATGGCACCTGTGTCTGCTAAAAAAGAAAAGAAAGTTTCCTGCATGTTCATTCCTGATGGGCGGGTGTCTGTCTCTGCTCGAATTGACAGAAAAGGATTCTGTGAAGGTGATGAGATTTCCATCCATGCTGACTTTGAGAATACATGTTCCCGAATTGTGGTCCCCAAAGCTGCCATTGTGGCCCGCCACACTTACCTTGCCAATGGCCAGACCAAGGTGCTGACTCAGAAGTTGTCATCAGTCAGAGGCAATCATATTATCTCAGGGACATGCGCATCATGGCGTGGCAAGAGCCTTCGGGTTCAGAAGATCAGGCCTTCTATCCTGGGCTGCAACATCCTTCGAGTTGAATATTCCTTACTGATCTATGTTAGCGTTCCTGGATCCAAGAAGGTCATCCTTGACCTGCCCCTGGTAATTGGCAGCAGATCAGGTCTAAGCAGCAGAACATCCAGCATGGCCAGCCGAACCAGCTCTGAGATGAGTTGGGTAGATCTGAACATCCCTGATACCCCAGAAGCTCCTCCCTGCTATATGGATGTCATTCCTGAAGATCACCGATTGGAGAGCCCAACCACTCCTCTGCTAGATGACATGGATGGCTCTCAAGACAGCCCTATCTTTATGTATGCCCCTGAGTTCAAGTTCATGCCACCACCGACTTATACTGAGGTGGATCCCTGCATCCTCAACAACAATGTGCAGTGA
ORF Protein Sequence MVMFKKIKSFEVVFNDPEKVYGSGEKVAGRVIVEVCEVTRVKAVRILACGVAKVLWMQGSQQCKQTSEYLRYEDTLLLEDQPTGENEMVIMRPGNKYEYKFGFELPQGPLGTSFKGKYGCVDYWVKAFLDRPSQPTQETKKNFEVVDLVDVNTPDLMAPVSAKKEKKVSCMFIPDGRVSVSARIDRKGFCEGDEISIHADFENTCSRIVVPKAAIVARHTYLANGQTKVLTQKLSSVRGNHIISGTCASWRGKSLRVQKIRPSILGCNILRVEYSLLIYVSVPGSKKVILDLPLVIGSRSGLSSRTSSMASRTSSEMSWVDLNIPDTPEAPPCYMDVIPEDHRLESPTTPLLDDMDGSQDSPIFMYAPEFKFMPPPTYTEVDPCILNNNVQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0163-Ab Anti-VDUP1 monoclonal antibody
    Target Antigen GM-Tg-g-IP0163-Ag VDUP1/TXNIP protein
    ORF Viral Vector pGMLV000188 Human TXNIP Lentivirus plasmid
    ORF Viral Vector pGMLV001158 Human TXNIP Lentivirus plasmid
    ORF Viral Vector pGMAP000591 Human TXNIP Adenovirus plasmid
    ORF Viral Vector pGMPC000243 Human TXNIP Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001146 Human TXNIP Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000188 Human TXNIP Lentivirus particle
    ORF Viral Vector vGMLV001158 Human TXNIP Lentivirus particle
    ORF Viral Vector vGMAP000591 Human TXNIP Adenovirus particle


    Target information

    Target ID GM-IP0163
    Target Name VDUP1
    Gene ID 10628, 56338, 698683, 117514, 101099739, 475829, 506790, 111773538
    Gene Symbol and Synonyms 1200008J08Rik,ARRDC6,EST01027,HHCPA78,Hyplip1,Tbp-2,THIF,TXNIP,VDUP1
    Uniprot Accession Q9H3M7
    Uniprot Entry Name TXNIP_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000265972
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a thioredoxin-binding protein that is a member of the alpha arrestin protein family. Thioredoxin is a thiol-oxidoreductase that is a major regulator of cellular redox signaling which protects cells from oxidative stress. This protein inhibits the antioxidative function of thioredoxin resulting in the accumulation of reactive oxygen species and cellular stress. This protein also functions as a regulator of cellular metabolism and of endoplasmic reticulum (ER) stress. This protein may also function as a tumor suppressor. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.