Human CLDN18/SFTA5/SFTPJ ORF/cDNA clone-Lentivirus plasmid (NM_016369.4)

Cat. No.: pGMLV001021
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CLDN18/SFTA5/SFTPJ Lentiviral expression plasmid for CLDN18 lentivirus packaging, CLDN18 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to CLDN18/SFTA5 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $496.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV001021
Gene Name CLDN18
Accession Number NM_016369.4
Gene ID 51208
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 786 bp
Gene Alias SFTA5,SFTPJ
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCCACCACCACATGCCAAGTGGTGGCGTTCCTCCTGTCCATCCTGGGGCTGGCCGGCTGCATCGCGGCCACCGGGATGGACATGTGGAGCACCCAGGACCTGTACGACAACCCCGTCACCTCCGTGTTCCAGTACGAAGGGCTCTGGAGGAGCTGCGTGAGGCAGAGTTCAGGCTTCACCGAATGCAGGCCCTATTTCACCATCCTGGGACTTCCAGCCATGCTGCAGGCAGTGCGAGCCCTGATGATCGTAGGCATCGTCCTGGGTGCCATTGGCCTCCTGGTATCCATCTTTGCCCTGAAATGCATCCGCATTGGCAGCATGGAGGACTCTGCCAAAGCCAACATGACACTGACCTCCGGGATCATGTTCATTGTCTCAGGTCTTTGTGCAATTGCTGGAGTGTCTGTGTTTGCCAACATGCTGGTGACTAACTTCTGGATGTCCACAGCTAACATGTACACCGGCATGGGTGGGATGGTGCAGACTGTTCAGACCAGGTACACATTTGGTGCGGCTCTGTTCGTGGGCTGGGTCGCTGGAGGCCTCACACTAATTGGGGGTGTGATGATGTGCATCGCCTGCCGGGGCCTGGCACCAGAAGAAACCAACTACAAAGCCGTTTCTTATCATGCCTCAGGCCACAGTGTTGCCTACAAGCCTGGAGGCTTCAAGGCCAGCACTGGCTTTGGGTCCAACACCAAAAACAAGAAGATATACGATGGAGGTGCCCGCACAGAGGACGAGGTACAATCTTATCCTTCCAAGCACGACTATGTGTAA
ORF Protein Sequence MSTTTCQVVAFLLSILGLAGCIAATGMDMWSTQDLYDNPVTSVFQYEGLWRSCVRQSSGFTECRPYFTILGLPAMLQAVRALMIVGIVLGAIGLLVSIFALKCIRIGSMEDSAKANMTLTSGIMFIVSGLCAIAGVSVFANMLVTNFWMSTANMYTGMGGMVQTVQTRYTFGAALFVGWVAGGLTLIGGVMMCIACRGLAPEETNYKAVSYHASGHSVAYKPGGFKASTGFGSNTKNKKIYDGGARTEDEVQSYPSKHDYV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-670 Pre-Made Gresonitamab biosimilar, Whole mAb, Anti-CLDN18;CD3E Antibody: Anti-SFTA5/SFTPJ;T3E/TCRE/IMD18 therapeutic antibody
    Biosimilar GMP-Bios-ab-109 Pre-Made Claudiximab biosimilar, Whole mAb, Anti-CLDN18 Antibody: Anti-SFTA5/SFTPJ therapeutic antibody
    Biosimilar GMP-Bios-ab-649 Pre-Made Zolbetuximab biosimilar, Whole mAb, Anti-CLDN18 Antibody: Anti-SFTA5/SFTPJ therapeutic antibody
    Target Antibody GM-Tg-g-T65883-Ab Anti-CLD18/ CLDN18/ SFTA5 monoclonal antibody
    Target Antigen GM-Tg-g-T65883-Ag CLDN18 VLP (virus-like particle)
    ORF Viral Vector pGMLV001021 Human CLDN18 Lentivirus plasmid
    ORF Viral Vector pGMLV001051 Human CLDN18 Lentivirus plasmid
    ORF Viral Vector pGMLV001052 Human CLDN18 Lentivirus plasmid
    ORF Viral Vector vGMLV001021 Human CLDN18 Lentivirus particle
    ORF Viral Vector vGMLV001051 Human CLDN18 Lentivirus particle
    ORF Viral Vector vGMLV001052 Human CLDN18 Lentivirus particle


    Target information

    Target ID GM-T65883
    Target Name CLDN18
    Gene ID 51208, 56492, 716628, 315953, 101093797, 477079, 511460, 100053444
    Gene Symbol and Synonyms CLDN18,SFTA5,SFTPJ
    Uniprot Accession P56856
    Uniprot Entry Name CLD18_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease Not Available
    Gene Ensembl ENSG00000066405
    Target Classification Checkpoint-Immuno Oncology

    This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is upregulated in patients with ulcerative colitis and highly overexpressed in infiltrating ductal adenocarcinomas. PKC/MAPK/AP-1 (protein kinase C/mitogen-activated protein kinase/activator protein-1) dependent pathway regulates the expression of this gene in gastric cells. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jun 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.