Human CLDN18/SFTA5/SFTPJ ORF/cDNA clone-Lentivirus plasmid (NM_001002026.3)
Cat. No.: pGMLV001052
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CLDN18/SFTA5/SFTPJ Lentiviral expression plasmid for CLDN18 lentivirus packaging, CLDN18 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
CLDN18/SFTA5 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLV001052 |
| Gene Name | CLDN18 |
| Accession Number | NM_001002026.3 |
| Gene ID | 51208 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 786 bp |
| Gene Alias | SFTA5,SFTPJ |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGCCGTGACTGCCTGTCAGGGCTTGGGGTTCGTGGTTTCACTGATTGGGATTGCGGGCATCATTGCTGCCACCTGCATGGACCAGTGGAGCACCCAAGACTTGTACAACAACCCCGTAACAGCTGTTTTCAACTACCAGGGGCTGTGGCGCTCCTGTGTCCGAGAGAGCTCTGGCTTCACCGAGTGCCGGGGCTACTTCACCCTGCTGGGGCTGCCAGCCATGCTGCAGGCAGTGCGAGCCCTGATGATCGTAGGCATCGTCCTGGGTGCCATTGGCCTCCTGGTATCCATCTTTGCCCTGAAATGCATCCGCATTGGCAGCATGGAGGACTCTGCCAAAGCCAACATGACACTGACCTCCGGGATCATGTTCATTGTCTCAGGTCTTTGTGCAATTGCTGGAGTGTCTGTGTTTGCCAACATGCTGGTGACTAACTTCTGGATGTCCACAGCTAACATGTACACCGGCATGGGTGGGATGGTGCAGACTGTTCAGACCAGGTACACATTTGGTGCGGCTCTGTTCGTGGGCTGGGTCGCTGGAGGCCTCACACTAATTGGGGGTGTGATGATGTGCATCGCCTGCCGGGGCCTGGCACCAGAAGAAACCAACTACAAAGCCGTTTCTTATCATGCCTCAGGCCACAGTGTTGCCTACAAGCCTGGAGGCTTCAAGGCCAGCACTGGCTTTGGGTCCAACACCAAAAACAAGAAGATATACGATGGAGGTGCCCGCACAGAGGACGAGGTACAATCTTATCCTTCCAAGCACGACTATGTGTAA |
| ORF Protein Sequence | MAVTACQGLGFVVSLIGIAGIIAATCMDQWSTQDLYNNPVTAVFNYQGLWRSCVRESSGFTECRGYFTLLGLPAMLQAVRALMIVGIVLGAIGLLVSIFALKCIRIGSMEDSAKANMTLTSGIMFIVSGLCAIAGVSVFANMLVTNFWMSTANMYTGMGGMVQTVQTRYTFGAALFVGWVAGGLTLIGGVMMCIACRGLAPEETNYKAVSYHASGHSVAYKPGGFKASTGFGSNTKNKKIYDGGARTEDEVQSYPSKHDYV |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Biosimilar | GMP-Bios-ab-670 | Pre-Made Gresonitamab biosimilar, Whole mAb, Anti-CLDN18;CD3E Antibody: Anti-SFTA5/SFTPJ;T3E/TCRE/IMD18 therapeutic antibody |
| Biosimilar | GMP-Bios-ab-109 | Pre-Made Claudiximab biosimilar, Whole mAb, Anti-CLDN18 Antibody: Anti-SFTA5/SFTPJ therapeutic antibody |
| Biosimilar | GMP-Bios-ab-649 | Pre-Made Zolbetuximab biosimilar, Whole mAb, Anti-CLDN18 Antibody: Anti-SFTA5/SFTPJ therapeutic antibody |
| Target Antibody | GM-Tg-g-T65883-Ab | Anti-CLD18/ CLDN18/ SFTA5 monoclonal antibody |
| Target Antigen | GM-Tg-g-T65883-Ag | CLDN18 VLP (virus-like particle) |
| ORF Viral Vector | pGMLV001021 | Human CLDN18 Lentivirus plasmid |
| ORF Viral Vector | pGMLV001051 | Human CLDN18 Lentivirus plasmid |
| ORF Viral Vector | pGMLV001052 | Human CLDN18 Lentivirus plasmid |
| ORF Viral Vector | vGMLV001021 | Human CLDN18 Lentivirus particle |
| ORF Viral Vector | vGMLV001051 | Human CLDN18 Lentivirus particle |
| ORF Viral Vector | vGMLV001052 | Human CLDN18 Lentivirus particle |
Target information
| Target ID | GM-T65883 |
| Target Name | CLDN18 |
| Gene ID | 51208, 56492, 716628, 315953, 101093797, 477079, 511460, 100053444 |
| Gene Symbol and Synonyms | CLDN18,SFTA5,SFTPJ |
| Uniprot Accession | P56856 |
| Uniprot Entry Name | CLD18_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target, Immuno-oncology Target, INN Index |
| Disease | Not Available |
| Gene Ensembl | ENSG00000066405 |
| Target Classification | Checkpoint-Immuno Oncology |
This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is upregulated in patients with ulcerative colitis and highly overexpressed in infiltrating ductal adenocarcinomas. PKC/MAPK/AP-1 (protein kinase C/mitogen-activated protein kinase/activator protein-1) dependent pathway regulates the expression of this gene in gastric cells. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jun 2010]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


