Human CDC25A/CDC25A2 ORF/cDNA clone-Lentivirus plasmid (NM_001789.3)

Cat. No.: pGMLV002081
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CDC25A/CDC25A2 Lentiviral expression plasmid for CDC25A lentivirus packaging, CDC25A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to MPIP1/CDC25A/CDC25A2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $788.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV002081
Gene Name CDC25A
Accession Number NM_001789.3
Gene ID 993
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1575 bp
Gene Alias CDC25A2
Fluorescent Reporter Null
Mammalian Cell Selection Blasticidin (BSD)
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAACTGGGCCCGGAGCCCCCGCACCGCCGCCGCCTGCTCTTCGCCTGCAGCCCCCCTCCCGCGTCGCAGCCCGTCGTGAAGGCGCTATTTGGCGCTTCAGCCGCCGGGGGACTGTCGCCTGTCACCAACCTGACCGTCACTATGGACCAGCTGCAGGGTCTGGGCAGTGATTATGAGCAACCACTGGAGGTGAAGAACAACAGTAATCTGCAGAGAATGGGCTCCTCCGAGTCAACAGATTCAGGTTTCTGTCTAGATTCTCCTGGGCCATTGGACAGTAAAGAAAACCTTGAAAATCCTATGAGAAGAATACATTCCCTACCTCAGAAGCTGTTGGGATGTAGTCCAGCTCTGAAGAGGAGCCATTCTGATTCTCTTGACCATGACATCTTTCAGCTCATCGACCCAGATGAGAACAAGGAAAATGAAGCCTTTGAGTTTAAGAAGCCAGTAAGACCTGTATCTCGTGGCTGCCTGCACTCTCATGGACTCCAGGAGGGTAAAGATCTCTTCACACAGAGGCAGAACTCTGCCCCAGCTCGGATGCTTTCCTCAAATGAAAGAGATAGCAGTGAACCAGGGAATTTCATTCCTCTTTTTACACCCCAGTCACCTGTGACAGCCACTTTGTCTGATGAGGATGATGGCTTCGTGGACCTTCTCGATGGAGAGAATCTGAAGAATGAGGAGGAGACCCCCTCGTGCATGGCAAGCCTCTGGACAGCTCCTCTCGTCATGAGAACTACAAACCTTGACAACCGATGCAAGCTGTTTGACTCCCCTTCCCTGTGTAGCTCCAGCACTCGGTCAGTGTTGAAGAGACCAGAACGATCTCAAGAGGAGTCTCCACCTGGAAGTACAAAGAGGAGGAAGAGCATGTCTGGGGCCAGCCCCAAAGAGTCAACTAATCCAGAGAAGGCCCATGAGACTCTTCATCAGTCTTTATCCCTGGCATCTTCCCCCAAAGGAACCATTGAGAACATTTTGGACAATGACCCAAGGGACCTTATAGGAGACTTCTCCAAGGGTTATCTCTTTCATACAGTTGCTGGGAAACATCAGGATTTAAAATACATCTCTCCAGAAATTATGGCATCTGTTTTGAATGGCAAGTTTGCCAACCTCATTAAAGAGTTTGTTATCATCGACTGTCGATACCCATATGAATACGAGGGAGGCCACATCAAGGGTGCAGTGAACTTGCACATGGAAGAAGAGGTTGAAGACTTCTTATTGAAGAAGCCCATTGTACCTACTGATGGCAAGCGTGTCATTGTTGTGTTTCACTGCGAGTTTTCTTCTGAGAGAGGTCCCCGCATGTGCCGGTATGTGAGAGAGAGAGATCGCCTGGGTAATGAATACCCCAAACTCCACTACCCTGAGCTGTATGTCCTGAAGGGGGGATACAAGGAGTTCTTTATGAAATGCCAGTCTTACTGTGAGCCCCCTAGCTACCGGCCCATGCACCACGAGGACTTTAAAGAAGACCTGAAGAAGTTCCGCACCAAGAGCCGGACCTGGGCAGGGGAGAAGAGCAAGAGGGAGATGTACAGTCGTCTGAAGAAGCTCTGA
ORF Protein Sequence MELGPEPPHRRRLLFACSPPPASQPVVKALFGASAAGGLSPVTNLTVTMDQLQGLGSDYEQPLEVKNNSNLQRMGSSESTDSGFCLDSPGPLDSKENLENPMRRIHSLPQKLLGCSPALKRSHSDSLDHDIFQLIDPDENKENEAFEFKKPVRPVSRGCLHSHGLQEGKDLFTQRQNSAPARMLSSNERDSSEPGNFIPLFTPQSPVTATLSDEDDGFVDLLDGENLKNEEETPSCMASLWTAPLVMRTTNLDNRCKLFDSPSLCSSSTRSVLKRPERSQEESPPGSTKRRKSMSGASPKESTNPEKAHETLHQSLSLASSPKGTIENILDNDPRDLIGDFSKGYLFHTVAGKHQDLKYISPEIMASVLNGKFANLIKEFVIIDCRYPYEYEGGHIKGAVNLHMEEEVEDFLLKKPIVPTDGKRVIVVFHCEFSSERGPRMCRYVRERDRLGNEYPKLHYPELYVLKGGYKEFFMKCQSYCEPPSYRPMHHEDFKEDLKKFRTKSRTWAGEKSKREMYSRLKKL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T30823-Ab Anti-MPIP1 monoclonal antibody
    Target Antigen GM-Tg-g-T30823-Ag MPIP1/CDC25A protein
    ORF Viral Vector pGMLP002735 Human CDC25A Lentivirus plasmid
    ORF Viral Vector pGMLV002081 Human CDC25A Lentivirus plasmid
    ORF Viral Vector vGMLP002735 Human CDC25A Lentivirus particle
    ORF Viral Vector vGMLV002081 Human CDC25A Lentivirus particle


    Target information

    Target ID GM-T30823
    Target Name MPIP1
    Gene ID 993, 12530, 710858, 171102, 101098445, 484780, 520188, 100064223
    Gene Symbol and Synonyms CDC25A,CDC25A2,D9Ertd393e
    Uniprot Accession P30304
    Uniprot Entry Name MPIP1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000164045
    Target Classification Tumor-associated antigen (TAA)

    CDC25A is a member of the CDC25 family of phosphatases. CDC25A is required for progression from G1 to the S phase of the cell cycle. It activates the cyclin-dependent kinase CDC2 by removing two phosphate groups. CDC25A is specifically degraded in response to DNA damage, which prevents cells with chromosomal abnormalities from progressing through cell division. CDC25A is an oncogene, although its exact role in oncogenesis has not been demonstrated. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.