Human CXCR2/CD182/CDw128b ORF/cDNA clone-Lentivirus plasmid (NM_001168298.2)
Cat. No.: pGMLV002388
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CXCR2/CD182/CDw128b Lentiviral expression plasmid for CXCR2 lentivirus packaging, CXCR2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
CXCR2/CD182 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLV002388 |
| Gene Name | CXCR2 |
| Accession Number | NM_001168298.2 |
| Gene ID | 3579 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 1083 bp |
| Gene Alias | CD182,CDw128b,CMKAR2,IL8R2,IL8RA,IL8RB,WHIMS2 |
| Fluorescent Reporter | mCherry |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGAAGATTTTAACATGGAGAGTGACAGCTTTGAAGATTTCTGGAAAGGTGAAGATCTTAGTAATTACAGTTACAGCTCTACCCTGCCCCCTTTTCTACTAGATGCCGCCCCATGTGAACCAGAATCCCTGGAAATCAACAAGTATTTTGTGGTCATTATCTATGCCCTGGTATTCCTGCTGAGCCTGCTGGGAAACTCCCTCGTGATGCTGGTCATCTTATACAGCAGGGTCGGCCGCTCCGTCACTGATGTCTACCTGCTGAACCTAGCCTTGGCCGACCTACTCTTTGCCCTGACCTTGCCCATCTGGGCCGCCTCCAAGGTGAATGGCTGGATTTTTGGCACATTCCTGTGCAAGGTGGTCTCACTCCTGAAGGAAGTCAACTTCTATAGTGGCATCCTGCTACTGGCCTGCATCAGTGTGGACCGTTACCTGGCCATTGTCCATGCCACACGCACACTGACCCAGAAGCGCTACTTGGTCAAATTCATATGTCTCAGCATCTGGGGTCTGTCCTTGCTCCTGGCCCTGCCTGTCTTACTTTTCCGAAGGACCGTCTACTCATCCAATGTTAGCCCAGCCTGCTATGAGGACATGGGCAACAATACAGCAAACTGGCGGATGCTGTTACGGATCCTGCCCCAGTCCTTTGGCTTCATCGTGCCACTGCTGATCATGCTGTTCTGCTACGGATTCACCCTGCGTACGCTGTTTAAGGCCCACATGGGGCAGAAGCACCGGGCCATGCGGGTCATCTTTGCTGTCGTCCTCATCTTCCTGCTCTGCTGGCTGCCCTACAACCTGGTCCTGCTGGCAGACACCCTCATGAGGACCCAGGTGATCCAGGAGACCTGTGAGCGCCGCAATCACATCGACCGGGCTCTGGATGCCACCGAGATTCTGGGCATCCTTCACAGCTGCCTCAACCCCCTCATCTACGCCTTCATTGGCCAGAAGTTTCGCCATGGACTCCTCAAGATTCTAGCTATACATGGCTTGATCAGCAAGGACTCCCTGCCCAAAGACAGCAGGCCTTCCTTTGTTGGCTCTTCTTCAGGGCACACTTCCACTACTCTCTAA |
| ORF Protein Sequence | MEDFNMESDSFEDFWKGEDLSNYSYSSTLPPFLLDAAPCEPESLEINKYFVVIIYALVFLLSLLGNSLVMLVILYSRVGRSVTDVYLLNLALADLLFALTLPIWAASKVNGWIFGTFLCKVVSLLKEVNFYSGILLLACISVDRYLAIVHATRTLTQKRYLVKFICLSIWGLSLLLALPVLLFRRTVYSSNVSPACYEDMGNNTANWRMLLRILPQSFGFIVPLLIMLFCYGFTLRTLFKAHMGQKHRAMRVIFAVVLIFLLCWLPYNLVLLADTLMRTQVIQETCERRNHIDRALDATEILGILHSCLNPLIYAFIGQKFRHGLLKILAIHGLISKDSLPKDSRPSFVGSSSGHTSTTL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T56923-Ab | Anti-CXCR2/ CD182/ CDw128b monoclonal antibody |
| Target Antigen | GM-Tg-g-T56923-Ag | CXCR2 VLP (virus-like particle) |
| Cytokine | cks-Tg-g-GM-T56923 | chemokine (C-X-C motif) receptor 2 (CXCR2) protein & antibody |
| ORF Viral Vector | pGMLP001481 | Human CXCR2 Lentivirus plasmid |
| ORF Viral Vector | pGMLV002388 | Human CXCR2 Lentivirus plasmid |
| ORF Viral Vector | pGMPC000938 | Human CXCR2 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLP001481 | Human CXCR2 Lentivirus particle |
| ORF Viral Vector | vGMLV002388 | Human CXCR2 Lentivirus particle |
Target information
| Target ID | GM-T56923 |
| Target Name | CXCR2 |
| Gene ID | 3579, 12765, 700407, 29385, 101085396, 478905, 782719, 100055552 |
| Gene Symbol and Synonyms | CD128,CD182,CDw128,CDw128b,CMKAR2,CXC-R2,CXCR-2,CXCR2,Gpcr16,IL-8rb,IL-8Rh,IL8R2,IL8RA,IL8RB,mIL-8RH,WHIMS2 |
| Uniprot Accession | P25025 |
| Uniprot Entry Name | CXCR2_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target, Immuno-oncology Target, Cytokine Target |
| Disease | Cancer |
| Gene Ensembl | ENSG00000180871 |
| Target Classification | Checkpoint-Immuno Oncology, GPCR, Tumor-associated antigen (TAA) |
The protein encoded by this gene is a member of the G-protein-coupled receptor family. This protein is a receptor for interleukin 8 (IL8). It binds to IL8 with high affinity, and transduces the signal through a G-protein activated second messenger system. This receptor also binds to chemokine (C-X-C motif) ligand 1 (CXCL1/MGSA), a protein with melanoma growth stimulating activity, and has been shown to be a major component required for serum-dependent melanoma cell growth. This receptor mediates neutrophil migration to sites of inflammation. The angiogenic effects of IL8 in intestinal microvascular endothelial cells are found to be mediated by this receptor. Knockout studies in mice suggested that this receptor controls the positioning of oligodendrocyte precursors in developing spinal cord by arresting their migration. This gene, IL8RA, a gene encoding another high affinity IL8 receptor, as well as IL8RBP, a pseudogene of IL8RB, form a gene cluster in a region mapped to chromosome 2q33-q36. Alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2009]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


