Human CXCR2/CD182/ CDw128b ORF/cDNA clone-Lentivirus particle (NM_001557)

Pre-made Human CXCR2/CD182/ CDw128b Lentiviral expression plasmid for CXCR2 lentivirus packaging, CXCR2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CXCR2/CD182 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001481 Human CXCR2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001481
Gene Name CXCR2
Accession Number NM_001557
Gene ID 3579
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1083 bp
Gene Alias CD182, CDw128b, CMKAR2, IL8R2, IL8RA, IL8RB
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAAGATTTTAACATGGAGAGTGACAGCTTTGAAGATTTCTGGAAAGGTGAAGATCTTAGTAATTACAGTTACAGCTCTACCCTGCCCCCTTTTCTACTAGATGCCGCCCCATGTGAACCAGAATCCCTGGAAATCAACAAGTATTTTGTGGTCATTATCTATGCCCTGGTATTCCTGCTGAGCCTGCTGGGAAACTCCCTCGTGATGCTGGTCATCTTATACAGCAGGGTCGGCCGCTCCGTCACTGATGTCTACCTGCTGAACCTAGCCTTGGCCGACCTACTCTTTGCCCTGACCTTGCCCATCTGGGCCGCCTCCAAGGTGAATGGCTGGATTTTTGGCACATTCCTGTGCAAGGTGGTCTCACTCCTGAAGGAAGTCAACTTCTATAGTGGCATCCTGCTACTGGCCTGCATCAGTGTGGACCGTTACCTGGCCATTGTCCATGCCACACGCACACTGACCCAGAAGCGCTACTTGGTCAAATTCATATGTCTCAGCATCTGGGGTCTGTCCTTGCTCCTGGCCCTGCCTGTCTTACTTTTCCGAAGGACCGTCTACTCATCCAATGTTAGCCCAGCCTGCTATGAGGACATGGGCAACAATACAGCAAACTGGCGGATGCTGTTACGGATCCTGCCCCAGTCCTTTGGCTTCATCGTGCCACTGCTGATCATGCTGTTCTGCTACGGATTCACCCTGCGTACGCTGTTTAAGGCCCACATGGGGCAGAAGCACCGGGCCATGCGGGTCATCTTTGCTGTCGTCCTCATCTTCCTGCTCTGCTGGCTGCCCTACAACCTGGTCCTGCTGGCAGACACCCTCATGAGGACCCAGGTGATCCAGGAGACCTGTGAGCGCCGCAATCACATCGACCGGGCTCTGGATGCCACCGAGATTCTGGGCATCCTTCACAGCTGCCTCAACCCCCTCATCTACGCCTTCATTGGCCAGAAGTTTCGCCATGGACTCCTCAAGATTCTAGCTATACATGGCTTGATCAGCAAGGACTCCCTGCCCAAAGACAGCAGGCCTTCCTTTGTTGGCTCTTCTTCAGGGCACACTTCCACTACTCTCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T56923-Ab Anti-CXCR2/ CD182/ CDw128b monoclonal antibody
    Target Antigen GM-Tg-g-T56923-Ag CXCR2 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T56923 chemokine (C-X-C motif) receptor 2 (CXCR2) protein & antibody
    ORF Viral Vector pGMPC000938 Human CXCR2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP001481 Human CXCR2 Lentivirus plasmid
    ORF Viral Vector vGMLP001481 Human CXCR2 Lentivirus particle
    ORF Viral Vector pGMLV002180 Mouse Cxcr2 Lentivirus plasmid
    ORF Viral Vector pGMLV002388 Human CXCR2 Lentivirus plasmid


    Target information

    Target ID GM-T56923
    Target Name CXCR2
    Gene ID 3579, 12765, 700407, 29385, 101085396, 478905, 782719, 100055552
    Gene Symbol and Synonyms CD128,CD182,CDw128,CDw128b,CMKAR2,CXC-R2,CXCR-2,CXCR2,Gpcr16,IL-8rb,IL-8Rh,IL8R2,IL8RA,IL8RB,mIL-8RH,WHIMS2
    Uniprot Accession P25025
    Uniprot Entry Name CXCR2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000180871
    Target Classification Checkpoint-Immuno Oncology, GPCR, Tumor-associated antigen (TAA)

    The protein encoded by this gene is a member of the G-protein-coupled receptor family. This protein is a receptor for interleukin 8 (IL8). It binds to IL8 with high affinity, and transduces the signal through a G-protein activated second messenger system. This receptor also binds to chemokine (C-X-C motif) ligand 1 (CXCL1/MGSA), a protein with melanoma growth stimulating activity, and has been shown to be a major component required for serum-dependent melanoma cell growth. This receptor mediates neutrophil migration to sites of inflammation. The angiogenic effects of IL8 in intestinal microvascular endothelial cells are found to be mediated by this receptor. Knockout studies in mice suggested that this receptor controls the positioning of oligodendrocyte precursors in developing spinal cord by arresting their migration. This gene, IL8RA, a gene encoding another high affinity IL8 receptor, as well as IL8RBP, a pseudogene of IL8RB, form a gene cluster in a region mapped to chromosome 2q33-q36. Alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2009]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.