Human MGAT1/GLCNAC-TI/GLCT1 ORF/cDNA clone-Lentivirus plasmid (NM_001114617.2)

Cat. No.: pGMLV002550
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MGAT1/GLCNAC-TI/GLCT1 Lentiviral expression plasmid for MGAT1 lentivirus packaging, MGAT1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to NAGAT1/MGAT1/GLCNAC-TI products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $674.64
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV002550
Gene Name MGAT1
Accession Number NM_001114617.2
Gene ID 4245
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1338 bp
Gene Alias GLCNAC-TI,GLCT1,GLYT1,GNT-1,GNT-I,GnTI,MGAT
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGAAGAAGCAGTCTGCAGGGCTTGTGCTGTGGGGCGCTATCCTCTTTGTGGCCTGGAATGCCCTGCTGCTCCTCTTCTTCTGGACGCGCCCAGCACCTGGCAGGCCACCCTCAGTCAGCGCTCTCGATGGCGACCCCGCCAGCCTCACCCGGGAAGTGATTCGCCTGGCCCAAGACGCCGAGGTGGAGCTGGAGCGGCAGCGTGGGCTGCTGCAGCAGATCGGGGATGCCCTGTCGAGCCAGCGGGGGAGGGTGCCCACCGCGGCCCCTCCCGCCCAGCCGCGTGTGCCTGTGACCCCCGCGCCGGCGGTGATTCCCATCCTGGTCATCGCCTGTGACCGCAGCACTGTTCGGCGCTGCCTGGACAAGCTGCTGCATTATCGGCCCTCGGCTGAGCTCTTCCCCATCATCGTTAGCCAGGACTGCGGGCACGAGGAGACGGCCCAGGCCATCGCCTCCTACGGCAGCGCGGTCACGCACATCCGGCAGCCCGACCTGAGCAGCATTGCGGTGCCGCCGGACCACCGCAAGTTCCAGGGCTACTACAAGATCGCGCGCCACTACCGCTGGGCGCTGGGCCAGGTCTTCCGGCAGTTTCGCTTCCCCGCGGCCGTGGTGGTGGAGGATGACCTGGAGGTGGCCCCGGACTTCTTCGAGTACTTTCGGGCCACCTATCCGCTGCTGAAGGCCGACCCCTCCCTGTGGTGCGTCTCGGCCTGGAATGACAACGGCAAGGAGCAGATGGTGGACGCCAGCAGGCCTGAGCTGCTCTACCGCACCGACTTTTTCCCTGGCCTGGGCTGGCTGCTGTTGGCCGAGCTCTGGGCTGAGCTGGAGCCCAAGTGGCCAAAGGCCTTCTGGGACGACTGGATGCGGCGGCCGGAGCAGCGGCAGGGGCGGGCCTGCATACGCCCTGAGATCTCAAGAACGATGACCTTTGGCCGCAAGGGTGTGAGCCACGGGCAGTTCTTTGACCAGCACCTCAAGTTTATCAAGCTGAACCAGCAGTTTGTGCACTTCACCCAGCTGGACCTGTCTTACCTGCAGCGGGAGGCCTATGACCGAGATTTCCTCGCCCGCGTCTACGGTGCTCCCCAGCTGCAGGTGGAGAAAGTGAGGACCAATGACCGGAAGGAGCTGGGGGAGGTGCGGGTGCAGTATACGGGCAGGGACAGCTTCAAGGCTTTCGCCAAGGCTCTGGGTGTCATGGATGACCTTAAGTCGGGGGTTCCGAGAGCTGGCTACCGGGGTATTGTCACCTTCCAGTTCCGGGGCCGCCGTGTCCACCTGGCGCCCCCACTGACGTGGGAGGGCTATGATCCTAGCTGGAATTAG
ORF Protein Sequence MLKKQSAGLVLWGAILFVAWNALLLLFFWTRPAPGRPPSVSALDGDPASLTREVIRLAQDAEVELERQRGLLQQIGDALSSQRGRVPTAAPPAQPRVPVTPAPAVIPILVIACDRSTVRRCLDKLLHYRPSAELFPIIVSQDCGHEETAQAIASYGSAVTHIRQPDLSSIAVPPDHRKFQGYYKIARHYRWALGQVFRQFRFPAAVVVEDDLEVAPDFFEYFRATYPLLKADPSLWCVSAWNDNGKEQMVDASRPELLYRTDFFPGLGWLLLAELWAELEPKWPKAFWDDWMRRPEQRQGRACIRPEISRTMTFGRKGVSHGQFFDQHLKFIKLNQQFVHFTQLDLSYLQREAYDRDFLARVYGAPQLQVEKVRTNDRKELGEVRVQYTGRDSFKAFAKALGVMDDLKSGVPRAGYRGIVTFQFRGRRVHLAPPLTWEGYDPSWN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0176-Ab Anti-NAGAT1 monoclonal antibody
    Target Antigen GM-Tg-g-IP0176-Ag NAGAT1/MGAT1 protein
    ORF Viral Vector pGMLV002550 Human MGAT1 Lentivirus plasmid
    ORF Viral Vector vGMLV002550 Human MGAT1 Lentivirus particle


    Target information

    Target ID GM-IP0176
    Target Name NAGAT1
    Gene ID 4245, 17308, 707375, 81519, 101082035, 534248, 102149649
    Gene Symbol and Synonyms GLCNAC-TI,GLCT1,GLYT1,GNT-1,GNT-I,GnTI,MGAT,Mgat-1,MGAT1
    Uniprot Accession P26572
    Uniprot Entry Name MGAT1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000131446
    Target Classification Not Available

    There are believed to be over 100 different glycosyltransferases involved in the synthesis of protein-bound and lipid-bound oligosaccharides. UDP-N-acetylglucosamine:alpha-3-D-mannoside beta-1,2-N-acetylglucosaminyltransferase I is a medial-Golgi enzyme essential for the synthesis of hybrid and complex N-glycans. The protein, encoded by a single exon, shows typical features of a type II transmembrane protein. The protein is believed to be essential for normal embryogenesis. Several variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.