Human OSM/MGC20461 ORF/cDNA clone-Adenovirus particle (BC011589)
Pre-made Human OSM/MGC20461 Adenovirus for OSM overexpression in-vitro and in-vivo. The OSM adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified OSM-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to OSM/MGC20461 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000088 | Human OSM Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000088 |
Gene Name | OSM |
Accession Number | BC011589 |
Gene ID | 5008 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 759 bp |
Gene Alias | MGC20461 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGGGTACTGCTCACACAGAGGACGCTGCTCAGTCTGGTCCTTGCACTCCTGTTTCCAAGCATGGCGAGCATGGCGGCTATAGGCAGCTGCTCGAAAGAGTACCGCGTGCTCCTTGGCCAGCTCCAGAAGCAGACAGATCTCATGCAGGACACCAGCAGACTCCTGGACCCCTATATACGTATCCAAGGCCTGGATGTTCCTAAACTGAGAGAGCACTGCAGGGAGCGCCCCGGGGCCTTCCCCAGTGAGGAGACCCTGAGGGGGCTGGGCAGGCGGGGCTTCCTGCAGACCCTCAATGCCACACTGGGCTGCGTCCTGCACAGACTGGCCGACTTAGAGCAGCGCCTCCCCAAGGCCCAGGATTTGGAGAGGTCTGGGCTGAACATCGAGGACTTGGAGAAGCTGCAGATGGCGAGGCCGAACATCCTCGGGCTCAGGAACAACATCTACTGCATGGCCCAGCTGCTGGACAACTCAGACACGGCTGAGCCCACGAAGGCTGGCCGGGGGGCCTCTCAGCCGCCCACCCCCACCCCTGCCTCGGATGCTTTTCAGCGCAAGCTGGAGGGCTGCAGGTTCCTGCATGGCTACCATCGCTTCATGCACTCAGTGGGGCGGGTCTTCAGCAAGTGGGGGGAGAGCCCGAACCGGAGCCGGAGACACAGCCCCCACCAGGCCCTGAGGAAGGGGGTGCGCAGGACCAGACCCTCCAGGAAAGGCAAGAGACTCATGACCAGGGGACAGCTGCCCCGGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T19556-Ab | Anti-ONCM/ OSM functional antibody |
Target Antigen | GM-Tg-g-T19556-Ag | OSM protein |
Cytokine | cks-Tg-g-GM-T19556 | oncostatin M (OSM) protein & antibody |
ORF Viral Vector | pGMAAV001208 | Rat Osm Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMLP000497 | Human OSM Lentivirus plasmid |
ORF Viral Vector | pGMAP000088 | Human OSM Adenovirus plasmid |
ORF Viral Vector | vGMAAV001208 | Rat Osm Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMLP000497 | Human OSM Lentivirus particle |
ORF Viral Vector | vGMAP000088 | Human OSM Adenovirus particle |
Target information
Target ID | GM-T19556 |
Target Name | OSM |
Gene ID | 5008, 18413, 717994, 289747, 101094379, 611921, 319086, 100064031 |
Gene Symbol and Synonyms | OncoM,OSM |
Uniprot Accession | P13725 |
Uniprot Entry Name | ONCM_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000099985 |
Target Classification | Not Available |
This gene encodes a member of the leukemia inhibitory factor/oncostatin-M (LIF/OSM) family of proteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein is a secreted cytokine and growth regulator that inhibits the proliferation of a number of tumor cell lines. This protein also regulates the production of other cytokines, including interleukin 6, granulocyte-colony stimulating factor and granulocyte-macrophage colony stimulating factor in endothelial cells. This gene and the related gene, leukemia inhibitory factor, also present on chromosome 22, may have resulted from the duplication of a common ancestral gene. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.