- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human OSM ORF/cDNA clone-Lentivirus particle (NM_020530)
Pre-made Human OSM/ Lentiviral expression plasmid for OSM lentivirus packaging, OSM lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to OSM/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP000497 | Human OSM Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP000497 |
| Gene Name | OSM |
| Accession Number | NM_020530 |
| Gene ID | 5008 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 759 bp |
| Gene Alias | |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGGGGGTACTGCTCACACAGAGGACGCTGCTCAGTCTGGTCCTTGCACTCCTGTTTCCAAGCATGGCGAGCATGGCGGCTATAGGCAGCTGCTCGAAAGAGTACCGCGTGCTCCTTGGCCAGCTCCAGAAGCAGACAGATCTCATGCAGGACACCAGCAGACTCCTGGACCCCTATATACGTATCCAAGGCCTGGATGTTCCTAAACTGAGAGAGCACTGCAGGGAGCGCCCCGGGGCCTTCCCCAGTGAGGAGACCCTGAGGGGGCTGGGCAGGCGGGGCTTCCTGCAGACCCTCAATGCCACACTGGGCTGCGTCCTGCACAGACTGGCCGACTTAGAGCAGCGCCTCCCCAAGGCCCAGGATTTGGAGAGGTCTGGGCTGAACATCGAGGACTTGGAGAAGCTGCAGATGGCGAGGCCGAACATCCTCGGGCTCAGGAACAACATCTACTGCATGGCCCAGCTGCTGGACAACTCAGACACGGCTGAGCCCACGAAGGCTGGCCGGGGGGCCTCTCAGCCGCCCACCCCCACCCCTGCCTCGGATGCTTTTCAGCGCAAGCTGGAGGGCTGCAGGTTCCTGCATGGCTACCATCGCTTCATGCACTCAGTGGGGCGGGTCTTCAGCAAGTGGGGGGAGAGCCCGAACCGGAGCCGGAGACACAGCCCCCACCAGGCCCTGAGGAAGGGGGTGCGCAGGACCAGACCCTCCAGGAAAGGCAAGAGACTCATGACCAGGGGACAGCTGCCCCGGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T19556-Ab | Anti-ONCM/ OSM functional antibody |
| Target Antigen | GM-Tg-g-T19556-Ag | OSM protein |
| Cytokine | cks-Tg-g-GM-T19556 | oncostatin M (OSM) protein & antibody |
| ORF Viral Vector | pGMAAV001208 | Rat Osm Adeno-associate virus(AAV) plasmid |
| ORF Viral Vector | pGMLP000497 | Human OSM Lentivirus plasmid |
| ORF Viral Vector | pGMAP000088 | Human OSM Adenovirus plasmid |
| ORF Viral Vector | vGMAAV001208 | Rat Osm Adeno-associate virus(AAV) particle |
| ORF Viral Vector | vGMLP000497 | Human OSM Lentivirus particle |
| ORF Viral Vector | vGMAP000088 | Human OSM Adenovirus particle |
Target information
| Target ID | GM-T19556 |
| Target Name | OSM |
| Gene ID | 5008, 18413, 717994, 289747, 101094379, 611921, 319086, 100064031 |
| Gene Symbol and Synonyms | OncoM,OSM |
| Uniprot Accession | P13725 |
| Uniprot Entry Name | ONCM_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target, Cytokine Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000099985 |
| Target Classification | Not Available |
This gene encodes a member of the leukemia inhibitory factor/oncostatin-M (LIF/OSM) family of proteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein is a secreted cytokine and growth regulator that inhibits the proliferation of a number of tumor cell lines. This protein also regulates the production of other cytokines, including interleukin 6, granulocyte-colony stimulating factor and granulocyte-macrophage colony stimulating factor in endothelial cells. This gene and the related gene, leukemia inhibitory factor, also present on chromosome 22, may have resulted from the duplication of a common ancestral gene. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
