Human PDGFRA/CD140A/ PDGFR2 ORF/cDNA clone-Adenovirus particle (BC015186)
Pre-made Human PDGFRA/CD140A/ PDGFR2 Adenovirus for PDGFRA overexpression in-vitro and in-vivo. The PDGFRA adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified PDGFRA-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to PDGFRA/CD140A products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000154 | Human PDGFRA Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000154 |
Gene Name | PDGFRA |
Accession Number | BC015186 |
Gene ID | 5156 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 657 bp |
Gene Alias | CD140A, PDGFR2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGGACTTCCCATCCGGCGTTCCTGGTCTTAGGCTGTCTTCTCACAGGGCTGAGCCTAATCCTCTGCCAGCTTTCATTACCCTCTATCCTTCCAAATGAAAATGAAAAGGTTGTGCAGCTGAATTCATCCTTTTCTCTGAGATGCTTTGGGGAGAGTGAAGTGAGCTGGCAGTACCCCATGTCTGAAGAAGAGAGCTCCGATGTGGAAATCAGAAATGAAGAAAACAACAGCGGCCTTTTTGTGACGGTCTTGGAAGTGAGCAGTGCCTCGGCGGCCCACACAGGGTTGTACACTTGCTATTACAACCACACTCAGACAGAAGAGAATGAGCTTGAAGGCAGGCACATTTACATCTATGTGCCAGACCCAGATGTAGCCTTTGTACCTCTAGGAATGACGGATTATTTAGTCATCGTGGAGGATGATGATTCTGCCATTATACCTTGTCGCACAACTGATCCCGAGACTCCTGTAACCTTACACAACAGTGAGGGGGTGGTACCTGCCTCCTACGACAGCAGACAGGGCTTTAATGGGACCTTCACTGTAGGGCCCTATATCTGTGAGGCCACCGTCAAAGGAAAGAAGTTCCAGACCATCCCATTTAATGTTTATGCTTTAAAAGGTACTTGTATCATCTCCTTCCTTCTTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-393 | Pre-Made Olaratumab biosimilar, Whole mAb, Anti-PDGFRA Antibody: Anti-CD140A/PDGFR-2/PDGFR2 therapeutic antibody |
Biosimilar | GMP-Bios-ab-590 | Pre-Made Tovetumab biosimilar, Whole mAb, Anti-PDGFRA Antibody: Anti-CD140A/PDGFR-2/PDGFR2 therapeutic antibody |
Target Antibody | GM-Tg-g-T53524-Ab | Anti-PGFRA/ PDGFRA/ CD140A monoclonal antibody |
Target Antigen | GM-Tg-g-T53524-Ag | PDGFRA VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-T53524 | Platelet-derived growth factor receptors (PDGF-R) are cell surface tyrosine kinase receptors for members of theplatelet-derived growth factor (PDGF) family. PDGF subunits -A and -B are important factors regulating cell proliferation, cellular differentiat (PDGFRA) protein & antibody |
ORF Viral Vector | pGMAP000154 | Human PDGFRA Adenovirus plasmid |
ORF Viral Vector | vGMAP000154 | Human PDGFRA Adenovirus particle |
Target information
Target ID | GM-T53524 |
Target Name | PDGFRA |
Gene ID | 5156, 18595, 697002, 25267, 101090765, 442860, 282301, 100059815 |
Gene Symbol and Synonyms | APDGFR,CD140A,PDGFACE,PDGFR-2,PDGFR2,PDGFRA |
Uniprot Accession | P16234 |
Uniprot Entry Name | PGFRA_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, INN Index, Cytokine Target |
Disease | Non-Small Cell Lung Cancer |
Gene Ensembl | ENSG00000134853 |
Target Classification | Not Available |
This gene encodes a cell surface tyrosine kinase receptor for members of the platelet-derived growth factor family. These growth factors are mitogens for cells of mesenchymal origin. The identity of the growth factor bound to a receptor monomer determines whether the functional receptor is a homodimer or a heterodimer, composed of both platelet-derived growth factor receptor alpha and beta polypeptides. Studies suggest that this gene plays a role in organ development, wound healing, and tumor progression. Mutations in this gene have been associated with idiopathic hypereosinophilic syndrome, somatic and familial gastrointestinal stromal tumors, and a variety of other cancers. [provided by RefSeq, Mar 2012]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.