Human CDC42EP1/BORG5/ CEP1 ORF/cDNA clone-Adenovirus particle (BC009356)
Pre-made Human CDC42EP1/BORG5/ CEP1 Adenovirus for CDC42EP1 overexpression in-vitro and in-vivo. The CDC42EP1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified CDC42EP1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to CDC42EP1/BORG5 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000532 | Human CDC42EP1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000532 |
Gene Name | CDC42EP1 |
Accession Number | BC009356 |
Gene ID | 11135 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 1155 bp |
Gene Alias | BORG5, CEP1, MGC15316, MSE55 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCCCGGCCCCCAGGGGGGCAGAGGCGCCGCCACCATGAGCCTGGGCAAGCTCTCGCCTGTGGGCTGGGTGTCCAGTTCACAGGGAAAGAGGCGGCTGACTGCAGACATGATCAGCCACCCACTCGGGGACTTCCGCCACACCATGCATGTGGGCCGTGGCGGGGATGTCTTCGGGGACACGTCCTTCCTCAGCAACCACGGTGGCAGCTCCGGGAGCACCCATCGCTCACCCCGCAGCTTCCTGGCCAAGAAGCTGCAGCTGGTGCGGAGGGTGGGGGCGCCCCCCCGGAGGATGGCATCTCCCCCTGCACCCTCCCCGGCTCCACCGGCCATCTCCCCCATCATCAAGAACGCCATCTCCCTGCCCCAGCTCAACCAGGCCGCCTACGACAGCCTCGTGGTTGGCAAGCTCAGCTTCGACAGCAGCCCCACCAGCTCCACGGACGGCCACTCCAGCTACGGCCTGGACTCTGGGTTCTGCACCATCTCCCGCCTGCCCCGCTCGGAAAAGCCGCATGACCGAGACCGGGATGGTTCCTTCCCCTCTGAGCCCGGGCTTCGCCGCTCTGACTCTCTCTTGTCCTTCCGCCTGGACCTCGACCTTGGGCCCTCACTCCTCAGCGAGCTGCTAGGGGTCATGAGCCTGCCAGAAGCCCCTGCAGCTGAGACTCCAGCCCCCGCTGCAAACCCCCCAGCCCCTACTGCAAACCCCACGGGTCCTGCTGCAAACCCCCCAGCCACTACTGCAAACCCCCCAGCACCTGCCGCAACCCCCACGGGTCCTGCTGCAAATCCCCCAGCCCCTGCCGCAAGCTCCACACCCCATGGACACTGTCCCAATGGGGTAACAGCTGGGTTGGGCCCAGTGGCTGAGGTGAAGTCCAGCCCAGTGGGAGGGGGTCCCCGAGGACCTGCTGGCCCTGCCCTCGGCAGGCACTGGGGAGCAGGCTGGGATGGCGGCCACCACTACCCAGAGATGGATGCGCGGCAGGAGCGGGTGGAGGTGCTGCCCCAAGCCCGGGCCTCCTGGGAGAGCCTGGACGAAGAGTGGAGGGCGCCCCAGGCAGGCAGCAGGACCCCAGTGCCCAGCACAGTGCAAGCAAACACCTTTGAATTTGCGGATGCTGAGGAGGATGATGAGGTCAAGGTGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP2043-Ab | Anti-BORG5/ CDC42EP1/ CEP1 monoclonal antibody |
Target Antigen | GM-Tg-g-MP2043-Ag | CDC42EP1 VLP (virus-like particle) |
ORF Viral Vector | pGMAP000532 | Human CDC42EP1 Adenovirus plasmid |
ORF Viral Vector | vGMAP000532 | Human CDC42EP1 Adenovirus particle |
Target information
Target ID | GM-MP2043 |
Target Name | CDC42EP1 |
Gene ID | 11135, 104445, 697553, 315121, 101097658, 481267, 511099, 100054751 |
Gene Symbol and Synonyms | 1810058K22Rik,BORG5,CDC42EP1,CEP1,MSE55 |
Uniprot Accession | Q00587 |
Uniprot Entry Name | BORG5_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000128283 |
Target Classification | Not Available |
CDC42 is a member of the Rho GTPase family that regulates multiple cellular activities, including actin polymerization. The protein encoded by this gene is a CDC42 binding protein that mediates actin cytoskeleton reorganization at the plasma membrane. This protein is secreted and is primarily found in bone marrow. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.