Human CDC42EP1/BORG5/ CEP1 ORF/cDNA clone-Adenovirus particle (BC009356)

Pre-made Human CDC42EP1/BORG5/ CEP1 Adenovirus for CDC42EP1 overexpression in-vitro and in-vivo. The CDC42EP1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified CDC42EP1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to CDC42EP1/BORG5 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000532 Human CDC42EP1 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000532
Gene Name CDC42EP1
Accession Number BC009356
Gene ID 11135
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1155 bp
Gene Alias BORG5, CEP1, MGC15316, MSE55
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCCCGGCCCCCAGGGGGGCAGAGGCGCCGCCACCATGAGCCTGGGCAAGCTCTCGCCTGTGGGCTGGGTGTCCAGTTCACAGGGAAAGAGGCGGCTGACTGCAGACATGATCAGCCACCCACTCGGGGACTTCCGCCACACCATGCATGTGGGCCGTGGCGGGGATGTCTTCGGGGACACGTCCTTCCTCAGCAACCACGGTGGCAGCTCCGGGAGCACCCATCGCTCACCCCGCAGCTTCCTGGCCAAGAAGCTGCAGCTGGTGCGGAGGGTGGGGGCGCCCCCCCGGAGGATGGCATCTCCCCCTGCACCCTCCCCGGCTCCACCGGCCATCTCCCCCATCATCAAGAACGCCATCTCCCTGCCCCAGCTCAACCAGGCCGCCTACGACAGCCTCGTGGTTGGCAAGCTCAGCTTCGACAGCAGCCCCACCAGCTCCACGGACGGCCACTCCAGCTACGGCCTGGACTCTGGGTTCTGCACCATCTCCCGCCTGCCCCGCTCGGAAAAGCCGCATGACCGAGACCGGGATGGTTCCTTCCCCTCTGAGCCCGGGCTTCGCCGCTCTGACTCTCTCTTGTCCTTCCGCCTGGACCTCGACCTTGGGCCCTCACTCCTCAGCGAGCTGCTAGGGGTCATGAGCCTGCCAGAAGCCCCTGCAGCTGAGACTCCAGCCCCCGCTGCAAACCCCCCAGCCCCTACTGCAAACCCCACGGGTCCTGCTGCAAACCCCCCAGCCACTACTGCAAACCCCCCAGCACCTGCCGCAACCCCCACGGGTCCTGCTGCAAATCCCCCAGCCCCTGCCGCAAGCTCCACACCCCATGGACACTGTCCCAATGGGGTAACAGCTGGGTTGGGCCCAGTGGCTGAGGTGAAGTCCAGCCCAGTGGGAGGGGGTCCCCGAGGACCTGCTGGCCCTGCCCTCGGCAGGCACTGGGGAGCAGGCTGGGATGGCGGCCACCACTACCCAGAGATGGATGCGCGGCAGGAGCGGGTGGAGGTGCTGCCCCAAGCCCGGGCCTCCTGGGAGAGCCTGGACGAAGAGTGGAGGGCGCCCCAGGCAGGCAGCAGGACCCCAGTGCCCAGCACAGTGCAAGCAAACACCTTTGAATTTGCGGATGCTGAGGAGGATGATGAGGTCAAGGTGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2043-Ab Anti-BORG5/ CDC42EP1/ CEP1 monoclonal antibody
    Target Antigen GM-Tg-g-MP2043-Ag CDC42EP1 VLP (virus-like particle)
    ORF Viral Vector pGMAP000532 Human CDC42EP1 Adenovirus plasmid
    ORF Viral Vector vGMAP000532 Human CDC42EP1 Adenovirus particle


    Target information

    Target ID GM-MP2043
    Target Name CDC42EP1
    Gene ID 11135, 104445, 697553, 315121, 101097658, 481267, 511099, 100054751
    Gene Symbol and Synonyms 1810058K22Rik,BORG5,CDC42EP1,CEP1,MSE55
    Uniprot Accession Q00587
    Uniprot Entry Name BORG5_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000128283
    Target Classification Not Available

    CDC42 is a member of the Rho GTPase family that regulates multiple cellular activities, including actin polymerization. The protein encoded by this gene is a CDC42 binding protein that mediates actin cytoskeleton reorganization at the plasma membrane. This protein is secreted and is primarily found in bone marrow. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.