Human TGFA/TFGA ORF/cDNA clone-Lentivirus particle (NM_001099691)

Pre-made Human TGFA/TFGA Lentiviral expression plasmid for TGFA lentivirus packaging, TGFA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to TGFA/TFGA products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000405 Human TGFA Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000405
Gene Name TGFA
Accession Number NM_001099691
Gene ID 7039
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 480 bp
Gene Alias TFGA
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGTCCCCTCGGCTGGACAGCTCGCCCTGTTCGCTCTGGGTATTGTGTTGGCTGCGTGCCAGGCCTTGGAGAACAGCACGTCCCCGCTGAGTGACCCGCCCGTGGCTGCAGCAGTGGTGTCCCATTTTAATGACTGCCCAGATTCCCACACTCAGTTCTGCTTCCATGGAACCTGCAGGTTTTTGGTGCAGGAGGACAAGCCAGCATGTGTCTGCCATTCTGGGTACGTTGGTGCACGCTGTGAGCATGCGGACCTCCTGGCCGTGGTGGCTGCCAGCCAGAAGAAGCAGGCCATCACCGCCTTGGTGGTGGTCTCCATCGTGGCCCTGGCTGTCCTTATCATCACATGTGTGCTGATACACTGCTGCCAGGTCCGAAAACACTGTGAGTGGTGCCGGGCCCTCATCTGCCGGCACGAGAAGCCCAGCGCCCTCCTGAAGGGAAGAACCGCTTGCTGCCACTCAGAAACAGTGGTCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T00033-Ab Anti-TGFA/ TFGA monoclonal antibody
    Target Antigen GM-Tg-g-T00033-Ag TGFA VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T00033 transforming growth factor, alpha (TGFA) protein & antibody
    ORF Viral Vector pGMLP000405 Human TGFA Lentivirus plasmid
    ORF Viral Vector pGMAP000120 Human TGFA Adenovirus plasmid
    ORF Viral Vector vGMLP000405 Human TGFA Lentivirus particle
    ORF Viral Vector vGMAP000120 Human TGFA Adenovirus particle


    Target information

    Target ID GM-T00033
    Target Name TGFA
    Gene ID 7039, 21802, 613031, 24827, 101094921, 403431, 540388, 100060423
    Gene Symbol and Synonyms RATTGFAA,TFGA,TGF alpha,TGFA,TGFAA,wa-1,wa1
    Uniprot Accession P01135
    Uniprot Entry Name TGFA_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Cytokine Target
    Disease cancer patients
    Gene Ensembl ENSG00000163235
    Target Classification Not Available

    This gene encodes a growth factor that is a ligand for the epidermal growth factor receptor, which activates a signaling pathway for cell proliferation, differentiation and development. This protein may act as either a transmembrane-bound ligand or a soluble ligand. This gene has been associated with many types of cancers, and it may also be involved in some cases of cleft lip/palate. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.