Human ORM2/AGP-B/AGP-B' ORF/cDNA clone-Lentivirus particle (NM_000608)

Cat. No.: vGMLP000434

Pre-made Human ORM2/AGP-B/AGP-B' Lentiviral expression plasmid for ORM2 lentivirus packaging, ORM2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to ORM2/AGP-B products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000434 Human ORM2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000434
Gene Name ORM2
Accession Number NM_000608
Gene ID 5005
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 606 bp
Gene Alias AGP-B,AGP-B',AGP2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGCTGTCCTGGGTTCTTACAGTCCTGAGCCTCCTACCTCTGCTGGAAGCCCAGATCCCATTGTGTGCCAACCTAGTACCGGTGCCCATCACCAACGCCACCCTGGACCGGATCACTGGCAAGTGGTTTTATATCGCATCGGCCTTTCGAAACGAGGAGTACAATAAGTCGGTTCAGGAGATCCAAGCAACCTTCTTTTACTTTACCCCCAACAAGACAGAGGACACGATCTTTCTCAGAGAGTACCAGACCCGCCAGAACCAGTGCTTCTATAACTCCAGTTACCTGAATGTCCAGCGGGAGAATGGGACCGTCTCCAGATACGAGGGAGGCCGAGAACATGTTGCTCACCTGCTGTTCCTTAGGGACACCAAGACCTTGATGTTTGGTTCCTACCTGGACGATGAGAAGAACTGGGGGCTGTCTTTCTATGCTGACAAGCCAGAGACGACCAAGGAGCAACTGGGAGAGTTCTACGAAGCTCTCGACTGCTTGTGCATTCCCAGGTCAGATGTCATGTACACCGACTGGAAAAAGGATAAGTGTGAGCCACTGGAGAAGCAGCACGAGAAGGAGAGGAAACAGGAGGAGGGGGAATCCTAG
ORF Protein Sequence MALSWVLTVLSLLPLLEAQIPLCANLVPVPITNATLDRITGKWFYIASAFRNEEYNKSVQEIQATFFYFTPNKTEDTIFLREYQTRQNQCFYNSSYLNVQRENGTVSRYEGGREHVAHLLFLRDTKTLMFGSYLDDEKNWGLSFYADKPETTKEQLGEFYEALDCLCIPRSDVMYTDWKKDKCEPLEKQHEKERKQEEGES

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1159-Ab Anti-A1AG2/ ORM2/ AGP-B functional antibody
    Target Antigen GM-Tg-g-SE1159-Ag ORM2 protein
    ORF Viral Vector pGMLP000434 Human ORM2 Lentivirus plasmid
    ORF Viral Vector vGMLP000434 Human ORM2 Lentivirus particle


    Target information

    Target ID GM-SE1159
    Target Name ORM2
    Gene ID 5005
    Gene Symbol and Synonyms AGP-B,AGP-B',AGP2,ORM2
    Uniprot Accession P19652
    Uniprot Entry Name A1AG2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Nephrotic syndrome
    Gene Ensembl ENSG00000228278
    Target Classification Not Available

    This gene encodes a key acute phase plasma protein.  Because of its increase due to acute inflammation, this protein is classified as an acute-phase reactant.  The specific function of this protein has not yet been determined; however, it may be involved in aspects of immunosuppression. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.