Human GDF15/GDF-15/ MIC-1 ORF/cDNA clone-Lentivirus particle (NM_004864)

Pre-made Human GDF15/GDF-15/ MIC-1 Lentiviral expression plasmid for GDF15 lentivirus packaging, GDF15 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to GDF15/GDF-15 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000446 Human GDF15 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000446
Gene Name GDF15
Accession Number NM_004864
Gene ID 9518
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 927 bp
Gene Alias GDF-15, MIC-1, MIC1, NAG-1, PDF, PLAB, PTGFB
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCCCGGGCAAGAACTCAGGACGGTGAATGGCTCTCAGATGCTCCTGGTGTTGCTGGTGCTCTCGTGGCTGCCGCATGGGGGCGCCCTGTCTCTGGCCGAGGCGAGCCGCGCAAGTTTCCCGGGACCCTCAGAGTTGCACTCCGAAGACTCCAGATTCCGAGAGTTGCGGAAACGCTACGAGGACCTGCTAACCAGGCTGCGGGCCAACCAGAGCTGGGAAGATTCGAACACCGACCTCGTCCCGGCCCCTGCAGTCCGGATACTCACGCCAGAAGTGCGGCTGGGATCCGGCGGCCACCTGCACCTGCGTATCTCTCGGGCCGCCCTTCCCGAGGGGCTCCCCGAGGCCTCCCGCCTTCACCGGGCTCTGTTCCGGCTGTCCCCGACGGCGTCAAGGTCGTGGGACGTGACACGACCGCTGCGGCGTCAGCTCAGCCTTGCAAGACCCCAGGCGCCCGCGCTGCACCTGCGACTGTCGCCGCCGCCGTCGCAGTCGGACCAACTGCTGGCAGAATCTTCGTCCGCACGGCCCCAGCTGGAGTTGCACTTGCGGCCGCAAGCCGCCAGGGGGCGCCGCAGAGCGCGTGCGCGCAACGGGGACCACTGTCCGCTCGGGCCCGGGCGTTGCTGCCGTCTGCACACGGTCCGCGCGTCGCTGGAAGACCTGGGCTGGGCCGATTGGGTGCTGTCGCCACGGGAGGTGCAAGTGACCATGTGCATCGGCGCGTGCCCGAGCCAGTTCCGGGCGGCAAACATGCACGCGCAGATCAAGACGAGCCTGCACCGCCTGAAGCCCGACACGGTGCCAGCGCCCTGCTGCGTGCCCGCCAGCTACAATCCCATGGTGCTCATTCAAAAGACCGACACCGGGGTGTCGCTCCAGACCTATGATGACTTGTTAGCCAAAGACTGCCACTGCATATGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-451 Pre-Made Ponsegromab biosimilar, Whole mAb, Anti-GDF15 Antibody: Anti-GDF-15/MIC-1/MIC1/NAG-1/PDF/PLAB/PTGFB therapeutic antibody
    Target Antibody GM-Tg-g-T33245-Ab Anti-GDF15/ GDF-15/ MIC-1 functional antibody
    Target Antigen GM-Tg-g-T33245-Ag GDF15 protein
    Cytokine cks-Tg-g-GM-T33245 growth differentiation factor 15 (GDF15) protein & antibody
    ORF Viral Vector pGMLP000446 Human GDF15 Lentivirus plasmid
    ORF Viral Vector vGMLP000446 Human GDF15 Lentivirus particle


    Target information

    Target ID GM-T33245
    Target Name GDF15
    Gene ID 9518, 23886, 719466, 29455, 101086633, 484822, 618677, 111769675
    Gene Symbol and Synonyms GDF-15,GDF15,MIC-1,MIC1,NAG-1,PDF,PLAB,PTGFB,SBF
    Uniprot Accession Q99988
    Uniprot Entry Name GDF15_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Diagnostics Biomarker, INN Index, Cytokine Target
    Disease Ovary Cancer
    Gene Ensembl ENSG00000130513
    Target Classification Not Available

    This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The protein is expressed in a broad range of cell types, acts as a pleiotropic cytokine and is involved in the stress response program of cells after cellular injury. Increased protein levels are associated with disease states such as tissue hypoxia, inflammation, acute injury and oxidative stress. [provided by RefSeq, Aug 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.