Human TOR1A/DQ2/DYT1 ORF/cDNA clone-Lentivirus particle (NM_000113)

Cat. No.: vGMLP001157

Pre-made Human TOR1A/DQ2/DYT1 Lentiviral expression plasmid for TOR1A lentivirus packaging, TOR1A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to TOR1A/DQ2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001157 Human TOR1A Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001157
Gene Name TOR1A
Accession Number NM_000113
Gene ID 1861
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 999 bp
Gene Alias DQ2,DYT1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGCTGGGCCGGGCCGTGCTGGGCCTGCTGCTGCTGGCGCCGTCCGTGGTGCAGGCGGTGGAGCCCATCAGCCTGGGACTGGCCCTGGCCGGCGTCCTCACCGGCTACATCTACCCGCGTCTCTACTGCCTCTTCGCCGAGTGCTGCGGGCAGAAGCGGAGCCTTAGCCGGGAGGCACTGCAGAAGGATCTGGACGACAACCTCTTTGGACAGCATCTTGCAAAGAAAATCATCTTAAATGCCGTGTTTGGTTTCATAAACAACCCAAAGCCCAAGAAACCTCTCACGCTCTCCCTGCACGGGTGGACAGGCACCGGCAAAAATTTCGTCAGCAAGATCATCGCAGAGAATATTTACGAGGGTGGTCTGAACAGTGACTATGTCCACCTGTTTGTGGCCACATTGCACTTTCCACATGCTTCAAACATCACCTTGTACAAGGATCAGTTACAGTTGTGGATTCGAGGCAACGTGAGTGCCTGTGCGAGGTCCATCTTCATATTTGATGAAATGGATAAGATGCATGCAGGCCTCATAGATGCCATCAAGCCTTTCCTCGACTATTATGACCTGGTGGATGGGGTCTCCTACCAGAAAGCCATGTTCATATTTCTCAGCAATGCTGGAGCAGAAAGGATCACAGATGTGGCTTTGGATTTCTGGAGGAGTGGAAAGCAGAGGGAAGACATCAAGCTCAAAGACATTGAACACGCGTTGTCTGTGTCGGTTTTCAATAACAAGAACAGTGGCTTCTGGCACAGCAGCTTAATTGACCGGAACCTCATTGATTATTTTGTTCCCTTCCTCCCCCTGGAATACAAACACCTAAAAATGTGTATCCGAGTGGAAATGCAGTCCCGAGGCTATGAAATTGATGAAGACATTGTAAGCAGAGTGGCTGAGGAGATGACATTTTTCCCCAAAGAGGAGAGAGTTTTCTCAGATAAAGGCTGCAAAACGGTGTTCACCAAGTTAGATTATTACTACGATGATTGA
ORF Protein Sequence MKLGRAVLGLLLLAPSVVQAVEPISLGLALAGVLTGYIYPRLYCLFAECCGQKRSLSREALQKDLDDNLFGQHLAKKIILNAVFGFINNPKPKKPLTLSLHGWTGTGKNFVSKIIAENIYEGGLNSDYVHLFVATLHFPHASNITLYKDQLQLWIRGNVSACARSIFIFDEMDKMHAGLIDAIKPFLDYYDLVDGVSYQKAMFIFLSNAGAERITDVALDFWRSGKQREDIKLKDIEHALSVSVFNNKNSGFWHSSLIDRNLIDYFVPFLPLEYKHLKMCIRVEMQSRGYEIDEDIVSRVAEEMTFFPKEERVFSDKGCKTVFTKLDYYYDD

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T70027-Ab Anti-TOR1A/ DQ2/ DYT1 functional antibody
    Target Antigen GM-Tg-g-T70027-Ag TOR1A protein
    ORF Viral Vector pGMLP001157 Human TOR1A Lentivirus plasmid
    ORF Viral Vector vGMLP001157 Human TOR1A Lentivirus particle


    Target information

    Target ID GM-T70027
    Target Name TOR1A
    Gene ID 1861, 30931, 722520, 266606, 101096018, 491296, 533699, 100629960
    Gene Symbol and Synonyms AMC5,DQ2,DYT1,TOR1A,torsinA
    Uniprot Accession O14656
    Uniprot Entry Name TOR1A_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000136827
    Target Classification Not Available

    The protein encoded by this gene is a member of the AAA family of adenosine triphosphatases (ATPases), is related to the Clp protease/heat shock family and is expressed prominently in the substantia nigra pars compacta. Mutations in this gene result in the autosomal dominant disorder, torsion dystonia 1. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.