Human PRKAA2/AMPK/ AMPK2 ORF/cDNA clone-Lentivirus particle (NM_006252.3)

Pre-made Human PRKAA2/AMPK/ AMPK2 Lentiviral expression plasmid for PRKAA2 lentivirus packaging, PRKAA2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to PRKAA2/AMPK products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001356 Human PRKAA2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001356
Gene Name PRKAA2
Accession Number NM_006252.3
Gene ID 5563
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1659 bp
Gene Alias AMPK, AMPK2, AMPKa2, PRKAA
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCTGAGAAGCAGAAGCACGACGGGCGGGTGAAGATCGGACACTACGTGCTGGGCGACACGCTGGGCGTCGGCACCTTCGGCAAAGTGAAGATTGGAGAACATCAATTAACAGGCCATAAAGTGGCAGTTAAAATCTTAAATAGACAGAAGATTCGCAGTTTAGATGTTGTTGGAAAAATAAAACGAGAAATTCAAAATCTAAAACTCTTTCGTCATCCTCATATTATCAAACTATACCAGGTGATCAGCACTCCAACAGATTTTTTTATGGTAATGGAATATGTGTCTGGAGGTGAATTATTTGACTACATCTGTAAGCATGGACGGGTTGAAGAGATGGAAGCCAGGCGGCTCTTTCAGCAGATTCTGTCTGCTGTGGATTACTGTCATAGGCATATGGTTGTTCATCGAGACCTGAAACCAGAGAATGTCCTGTTGGATGCACACATGAATGCCAAGATAGCCGATTTCGGATTATCTAATATGATGTCAGATGGTGAATTTCTGAGAACTAGTTGCGGATCTCCAAATTATGCAGCACCTGAAGTCATCTCAGGCAGATTGTATGCAGGTCCTGAAGTTGATATCTGGAGCTGTGGTGTTATCTTGTATGCTCTTCTTTGTGGCACCCTCCCATTTGATGATGAGCATGTACCTACGTTATTTAAGAAGATCCGAGGGGGTGTCTTTTATATCCCAGAATATCTCAATCGTTCTGTCGCCACTCTCCTGATGCATATGCTGCAGGTTGACCCACTGAAACGAGCAACTATCAAAGACATAAGAGAGCATGAATGGTTTAAACAAGATTTGCCCAGTTACTTATTTCCTGAAGACCCTTCCTATGATGCTAACGTCATTGATGATGAGGCTGTGAAAGAAGTGTGTGAAAAATTTGAATGTACAGAATCAGAAGTAATGAACAGTTTATATAGTGGTGACCCTCAAGACCAGCTTGCAGTGGCTTATCATCTTATCATTGACAATCGGAGAATAATGAACCAAGCCAGTGAGTTCTACCTCGCCTCTAGTCCTCCATCTGGTTCTTTTATGGATGATAGTGCCATGCATATTCCCCCAGGCCTGAAACCTCATCCAGAAAGGATGCCACCTCTTATAGCAGACAGCCCCAAAGCAAGATGTCCATTGGATGCACTGAATACGACTAAGCCCAAATCTTTAGCTGTGAAAAAAGCCAAGTGGCATCTTGGAATCCGAAGTCAGAGCAAACCGTATGACATTATGGCTGAAGTTTACCGAGCTATGAAGCAGCTGGATTTTGAATGGAAGGTAGTGAATGCATACCATCTTCGTGTAAGAAGAAAAAATCCAGTGACTGGCAATTACGTGAAAATGAGCTTACAACTTTACCTGGTTGATAACAGGAGCTATCTTTTGGACTTTAAAAGCATTGATGATGAAGTAGTGGAGCAGAGATCTGGTTCCTCAACACCTCAGCGTTCCTGTTCTGCTGCTGGCTTACACAGACCAAGATCAAGTTTTGATTCCACAACTGCAGAGAGCCATTCACTTTCTGGCTCTCTCACTGGCTCTTTGACCGGAAGCACATTGTCTTCAGTTTCACCTCGCCTGGGCAGTCACACCATGGATTTTTTTGAAATGTGTGCCAGTCTGATTACTACTTTAGCCCGTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1444-Ab Anti-PRKAA2 monoclonal antibody
    Target Antigen GM-Tg-g-IP1444-Ag PRKAA2 protein
    ORF Viral Vector pGMAAV000081 Rat Prkaa2 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMLP001356 Human PRKAA2 Lentivirus plasmid
    ORF Viral Vector pGMLP001898 Human PRKAA2 Lentivirus plasmid
    ORF Viral Vector vGMAAV000081 Rat Prkaa2 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP001356 Human PRKAA2 Lentivirus particle
    ORF Viral Vector vGMLP001898 Human PRKAA2 Lentivirus particle


    Target information

    Target ID GM-IP1444
    Target Name PRKAA2
    Gene ID 5563, 108079, 717703, 78975, 101096000, 489571, 538954, 100034159
    Gene Symbol and Synonyms 2310008I11Rik,A830082D05,AMPK,AMPK2,AMPKa2,AMPKalpha2,PRKAA,PRKAA2
    Uniprot Accession P54646
    Uniprot Entry Name AAPK2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000162409
    Target Classification Kinase

    The protein encoded by this gene is a catalytic subunit of the AMP-activated protein kinase (AMPK). AMPK is a heterotrimer consisting of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK is an important energy-sensing enzyme that monitors cellular energy status. In response to cellular metabolic stresses, AMPK is activated, and thus phosphorylates and inactivates acetyl-CoA carboxylase (ACC) and beta-hydroxy beta-methylglutaryl-CoA reductase (HMGCR), key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. Studies of the mouse counterpart suggest that this catalytic subunit may control whole-body insulin sensitivity and is necessary for maintaining myocardial energy homeostasis during ischemia. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.