Human PRKAA2/AMPK/ AMPK2 ORF/cDNA clone-Lentivirus particle (NM_006252.3)
Pre-made Human PRKAA2/AMPK/ AMPK2 Lentiviral expression plasmid for PRKAA2 lentivirus packaging, PRKAA2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to PRKAA2/AMPK products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP001898 | Human PRKAA2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP001898 |
Gene Name | PRKAA2 |
Accession Number | NM_006252.3 |
Gene ID | 5563 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1659 bp |
Gene Alias | AMPK, AMPK2, AMPKa2, PRKAA |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCTGAGAAGCAGAAGCACGACGGGCGGGTGAAGATCGGACACTACGTGCTGGGCGACACGCTGGGCGTCGGCACCTTCGGCAAAGTGAAGATTGGAGAACATCAATTAACAGGCCATAAAGTGGCAGTTAAAATCTTAAATAGACAGAAGATTCGCAGTTTAGATGTTGTTGGAAAAATAAAACGAGAAATTCAAAATCTAAAACTCTTTCGTCATCCTCATATTATCAAACTATACCAGGTGATCAGCACTCCAACAGATTTTTTTATGGTAATGGAATATGTGTCTGGAGGTGAATTATTTGACTACATCTGTAAGCATGGACGGGTTGAAGAGATGGAAGCCAGGCGGCTCTTTCAGCAGATTCTGTCTGCTGTGGATTACTGTCATAGGCATATGGTTGTTCATCGAGACCTGAAACCAGAGAATGTCCTGTTGGATGCACACATGAATGCCAAGATAGCCGATTTCGGATTATCTAATATGATGTCAGATGGTGAATTTCTGAGAACTAGTTGCGGATCTCCAAATTATGCAGCACCTGAAGTCATCTCAGGCAGATTGTATGCAGGTCCTGAAGTTGATATCTGGAGCTGTGGTGTTATCTTGTATGCTCTTCTTTGTGGCACCCTCCCATTTGATGATGAGCATGTACCTACGTTATTTAAGAAGATCCGAGGGGGTGTCTTTTATATCCCAGAATATCTCAATCGTTCTGTCGCCACTCTCCTGATGCATATGCTGCAGGTTGACCCACTGAAACGAGCAACTATCAAAGACATAAGAGAGCATGAATGGTTTAAACAAGATTTGCCCAGTTACTTATTTCCTGAAGACCCTTCCTATGATGCTAACGTCATTGATGATGAGGCTGTGAAAGAAGTGTGTGAAAAATTTGAATGTACAGAATCAGAAGTAATGAACAGTTTATATAGTGGTGACCCTCAAGACCAGCTTGCAGTGGCTTATCATCTTATCATTGACAATCGGAGAATAATGAACCAAGCCAGTGAGTTCTACCTCGCCTCTAGTCCTCCATCTGGTTCTTTTATGGATGATAGTGCCATGCATATTCCCCCAGGCCTGAAACCTCATCCAGAAAGGATGCCACCTCTTATAGCAGACAGCCCCAAAGCAAGATGTCCATTGGATGCACTGAATACGACTAAGCCCAAATCTTTAGCTGTGAAAAAAGCCAAGTGGCATCTTGGAATCCGAAGTCAGAGCAAACCGTATGACATTATGGCTGAAGTTTACCGAGCTATGAAGCAGCTGGATTTTGAATGGAAGGTAGTGAATGCATACCATCTTCGTGTAAGAAGAAAAAATCCAGTGACTGGCAATTACGTGAAAATGAGCTTACAACTTTACCTGGTTGATAACAGGAGCTATCTTTTGGACTTTAAAAGCATTGATGATGAAGTAGTGGAGCAGAGATCTGGTTCCTCAACACCTCAGCGTTCCTGTTCTGCTGCTGGCTTACACAGACCAAGATCAAGTTTTGATTCCACAACTGCAGAGAGCCATTCACTTTCTGGCTCTCTCACTGGCTCTTTGACCGGAAGCACATTGTCTTCAGTTTCACCTCGCCTGGGCAGTCACACCATGGATTTTTTTGAAATGTGTGCCAGTCTGATTACTACTTTAGCCCGTTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP1444-Ab | Anti-PRKAA2 monoclonal antibody |
Target Antigen | GM-Tg-g-IP1444-Ag | PRKAA2 protein |
ORF Viral Vector | pGMAAV000081 | Rat Prkaa2 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMLP001356 | Human PRKAA2 Lentivirus plasmid |
ORF Viral Vector | pGMLP001898 | Human PRKAA2 Lentivirus plasmid |
ORF Viral Vector | vGMAAV000081 | Rat Prkaa2 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMLP001356 | Human PRKAA2 Lentivirus particle |
ORF Viral Vector | vGMLP001898 | Human PRKAA2 Lentivirus particle |
Target information
Target ID | GM-IP1444 |
Target Name | PRKAA2 |
Gene ID | 5563, 108079, 717703, 78975, 101096000, 489571, 538954, 100034159 |
Gene Symbol and Synonyms | 2310008I11Rik,A830082D05,AMPK,AMPK2,AMPKa2,AMPKalpha2,PRKAA,PRKAA2 |
Uniprot Accession | P54646 |
Uniprot Entry Name | AAPK2_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000162409 |
Target Classification | Kinase |
The protein encoded by this gene is a catalytic subunit of the AMP-activated protein kinase (AMPK). AMPK is a heterotrimer consisting of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK is an important energy-sensing enzyme that monitors cellular energy status. In response to cellular metabolic stresses, AMPK is activated, and thus phosphorylates and inactivates acetyl-CoA carboxylase (ACC) and beta-hydroxy beta-methylglutaryl-CoA reductase (HMGCR), key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. Studies of the mouse counterpart suggest that this catalytic subunit may control whole-body insulin sensitivity and is necessary for maintaining myocardial energy homeostasis during ischemia. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.