Human CX3CR1/CCRL1/ CMKBRL1 ORF/cDNA clone-Lentivirus particle (NM_001337.3)
Pre-made Human CX3CR1/CCRL1/ CMKBRL1 Lentiviral expression plasmid for CX3CR1 lentivirus packaging, CX3CR1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to CX3CR1/CCRL1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP001885 | Human CX3CR1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP001885 |
Gene Name | CX3CR1 |
Accession Number | NM_001337.3 |
Gene ID | 1524 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1068 bp |
Gene Alias | CCRL1, CMKBRL1, CMKDR1, GPR13, GPRV28, V28 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGATCAGTTCCCTGAATCAGTGACAGAAAACTTTGAGTACGATGATTTGGCTGAGGCCTGTTATATTGGGGACATCGTGGTCTTTGGGACTGTGTTCCTGTCCATATTCTACTCCGTCATCTTTGCCATTGGCCTGGTGGGAAATTTGTTGGTAGTGTTTGCCCTCACCAACAGCAAGAAGCCCAAGAGTGTCACCGACATTTACCTCCTGAACCTGGCCTTGTCTGATCTGCTGTTTGTAGCCACTTTGCCCTTCTGGACTCACTATTTGATAAATGAAAAGGGCCTCCACAATGCCATGTGCAAATTCACTACCGCCTTCTTCTTCATCGGCTTTTTTGGAAGCATATTCTTCATCACCGTCATCAGCATTGATAGGTACCTGGCCATCGTCCTGGCCGCCAACTCCATGAACAACCGGACCGTGCAGCATGGCGTCACCATCAGCCTAGGCGTCTGGGCAGCAGCCATTTTGGTGGCAGCACCCCAGTTCATGTTCACAAAGCAGAAAGAAAATGAATGCCTTGGTGACTACCCCGAGGTCCTCCAGGAAATCTGGCCCGTGCTCCGCAATGTGGAAACAAATTTTCTTGGCTTCCTACTCCCCCTGCTCATTATGAGTTATTGCTACTTCAGAATCATCCAGACGCTGTTTTCCTGCAAGAACCACAAGAAAGCCAAAGCCATTAAACTGATCCTTCTGGTGGTCATCGTGTTTTTCCTCTTCTGGACACCCTACAACGTTATGATTTTCCTGGAGACGCTTAAGCTCTATGACTTCTTTCCCAGTTGTGACATGAGGAAGGATCTGAGGCTGGCCCTCAGTGTGACTGAGACGGTTGCATTTAGCCATTGTTGCCTGAATCCTCTCATCTATGCATTTGCTGGGGAGAAGTTCAGAAGATACCTTTACCACCTGTATGGGAAATGCCTGGCTGTCCTGTGTGGGCGCTCAGTCCACGTTGATTTCTCCTCATCTGAATCACAAAGGAGCAGGCATGGAAGTGTTCTGAGCAGCAATTTTACTTACCACACGAGTGATGGAGATGCATTGCTCCTTCTCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T15033-Ab | Anti-CX3C1/ CX3CR1/ CCRL1 monoclonal antibody |
Target Antigen | GM-Tg-g-T15033-Ag | CX3CR1 VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-T15033 | chemokine (C-X3-C motif) receptor 1 (CX3CR1) protein & antibody |
ORF Viral Vector | pGMLP001885 | Human CX3CR1 Lentivirus plasmid |
ORF Viral Vector | vGMLP001885 | Human CX3CR1 Lentivirus particle |
Target information
Target ID | GM-T15033 |
Target Name | CX3CR1 |
Gene ID | 1524, 13051, 693926, 171056, 101099898, 485599, 100124525, 100068350 |
Gene Symbol and Synonyms | CCRL1,CMKBRL1,CMKDR1,CX3CR1,GPR13,GPRV28,mCX3CR1,Rbs11,V28 |
Uniprot Accession | P49238 |
Uniprot Entry Name | CX3C1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target, Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000168329 |
Target Classification | Checkpoint-Immuno Oncology, GPCR |
Fractalkine is a transmembrane protein and chemokine involved in the adhesion and migration of leukocytes. The protein encoded by this gene is a receptor for fractalkine. The encoded protein also is a coreceptor for HIV-1, and some variations in this gene lead to increased susceptibility to HIV-1 infection and rapid progression to AIDS. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.