Human CX3CR1/CCRL1/ CMKBRL1 ORF/cDNA clone-Lentivirus particle (NM_001337.3)

Pre-made Human CX3CR1/CCRL1/ CMKBRL1 Lentiviral expression plasmid for CX3CR1 lentivirus packaging, CX3CR1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CX3CR1/CCRL1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001885 Human CX3CR1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001885
Gene Name CX3CR1
Accession Number NM_001337.3
Gene ID 1524
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1068 bp
Gene Alias CCRL1, CMKBRL1, CMKDR1, GPR13, GPRV28, V28
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGATCAGTTCCCTGAATCAGTGACAGAAAACTTTGAGTACGATGATTTGGCTGAGGCCTGTTATATTGGGGACATCGTGGTCTTTGGGACTGTGTTCCTGTCCATATTCTACTCCGTCATCTTTGCCATTGGCCTGGTGGGAAATTTGTTGGTAGTGTTTGCCCTCACCAACAGCAAGAAGCCCAAGAGTGTCACCGACATTTACCTCCTGAACCTGGCCTTGTCTGATCTGCTGTTTGTAGCCACTTTGCCCTTCTGGACTCACTATTTGATAAATGAAAAGGGCCTCCACAATGCCATGTGCAAATTCACTACCGCCTTCTTCTTCATCGGCTTTTTTGGAAGCATATTCTTCATCACCGTCATCAGCATTGATAGGTACCTGGCCATCGTCCTGGCCGCCAACTCCATGAACAACCGGACCGTGCAGCATGGCGTCACCATCAGCCTAGGCGTCTGGGCAGCAGCCATTTTGGTGGCAGCACCCCAGTTCATGTTCACAAAGCAGAAAGAAAATGAATGCCTTGGTGACTACCCCGAGGTCCTCCAGGAAATCTGGCCCGTGCTCCGCAATGTGGAAACAAATTTTCTTGGCTTCCTACTCCCCCTGCTCATTATGAGTTATTGCTACTTCAGAATCATCCAGACGCTGTTTTCCTGCAAGAACCACAAGAAAGCCAAAGCCATTAAACTGATCCTTCTGGTGGTCATCGTGTTTTTCCTCTTCTGGACACCCTACAACGTTATGATTTTCCTGGAGACGCTTAAGCTCTATGACTTCTTTCCCAGTTGTGACATGAGGAAGGATCTGAGGCTGGCCCTCAGTGTGACTGAGACGGTTGCATTTAGCCATTGTTGCCTGAATCCTCTCATCTATGCATTTGCTGGGGAGAAGTTCAGAAGATACCTTTACCACCTGTATGGGAAATGCCTGGCTGTCCTGTGTGGGCGCTCAGTCCACGTTGATTTCTCCTCATCTGAATCACAAAGGAGCAGGCATGGAAGTGTTCTGAGCAGCAATTTTACTTACCACACGAGTGATGGAGATGCATTGCTCCTTCTCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T15033-Ab Anti-CX3C1/ CX3CR1/ CCRL1 monoclonal antibody
    Target Antigen GM-Tg-g-T15033-Ag CX3CR1 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T15033 chemokine (C-X3-C motif) receptor 1 (CX3CR1) protein & antibody
    ORF Viral Vector pGMLP001885 Human CX3CR1 Lentivirus plasmid
    ORF Viral Vector vGMLP001885 Human CX3CR1 Lentivirus particle


    Target information

    Target ID GM-T15033
    Target Name CX3CR1
    Gene ID 1524, 13051, 693926, 171056, 101099898, 485599, 100124525, 100068350
    Gene Symbol and Synonyms CCRL1,CMKBRL1,CMKDR1,CX3CR1,GPR13,GPRV28,mCX3CR1,Rbs11,V28
    Uniprot Accession P49238
    Uniprot Entry Name CX3C1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000168329
    Target Classification Checkpoint-Immuno Oncology, GPCR

    Fractalkine is a transmembrane protein and chemokine involved in the adhesion and migration of leukocytes. The protein encoded by this gene is a receptor for fractalkine. The encoded protein also is a coreceptor for HIV-1, and some variations in this gene lead to increased susceptibility to HIV-1 infection and rapid progression to AIDS. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.