Human ADORA1/RDC7 ORF/cDNA clone-Lentivirus particle (NM_000674)

Pre-made Human ADORA1/RDC7 Lentiviral expression plasmid for ADORA1 lentivirus packaging, ADORA1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to ADORA1/RDC7 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002707 Human ADORA1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002707
Gene Name ADORA1
Accession Number NM_000674
Gene ID 134
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 981 bp
Gene Alias RDC7
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCCGCCCTCCATCTCAGCTTTCCAGGCCGCCTACATCGGCATCGAGGTGCTCATCGCCCTGGTCTCTGTGCCCGGGAACGTGCTGGTGATCTGGGCGGTGAAGGTGAACCAGGCGCTGCGGGATGCCACCTTCTGCTTCATCGTGTCGCTGGCGGTGGCTGATGTGGCCGTGGGTGCCCTGGTCATCCCCCTCGCCATCCTCATCAACATTGGGCCACAGACCTACTTCCACACCTGCCTCATGGTTGCCTGTCCGGTCCTCATCCTCACCCAGAGCTCCATCCTGGCCCTGCTGGCAATTGCTGTGGACCGCTACCTCCGGGTCAAGATCCCTCTCCGGTACAAGATGGTGGTGACCCCCCGGAGGGCGGCGGTGGCCATAGCCGGCTGCTGGATCCTCTCCTTCGTGGTGGGACTGACCCCTATGTTTGGCTGGAACAATCTGAGTGCGGTGGAGCGGGCCTGGGCAGCCAACGGCAGCATGGGGGAGCCCGTGATCAAGTGCGAGTTCGAGAAGGTCATCAGCATGGAGTACATGGTCTACTTCAACTTCTTTGTGTGGGTGCTGCCCCCGCTTCTCCTCATGGTCCTCATCTACCTGGAGGTCTTCTACCTAATCCGCAAGCAGCTCAACAAGAAGGTGTCGGCCTCCTCCGGCGACCCGCAGAAGTACTATGGGAAGGAGCTGAAGATCGCCAAGTCGCTGGCCCTCATCCTCTTCCTCTTTGCCCTCAGCTGGCTGCCTTTGCACATCCTCAACTGCATCACCCTCTTCTGCCCGTCCTGCCACAAGCCCAGCATCCTTACCTACATTGCCATCTTCCTCACGCACGGCAACTCGGCCATGAACCCCATTGTCTATGCCTTCCGCATCCAGAAGTTCCGCGTCACCTTCCTTAAGATTTGGAATGACCATTTCCGCTGCCAGCCTGCACCTCCCATTGACGAGGATCTCCCAGAAGAGAGGCCTGATGACTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T92072-Ab Anti-AA1R/ ADORA1/ RDC7 monoclonal antibody
    Target Antigen GM-Tg-g-T92072-Ag ADORA1 VLP (virus-like particle)
    ORF Viral Vector pGMLP002707 Human ADORA1 Lentivirus plasmid
    ORF Viral Vector pGMLP004056 Human ADORA1 Lentivirus plasmid
    ORF Viral Vector vGMLP002707 Human ADORA1 Lentivirus particle
    ORF Viral Vector vGMLP004056 Human ADORA1 Lentivirus particle


    Target information

    Target ID GM-T92072
    Target Name ADORA1
    Gene ID 134, 11539, 703638, 29290, 101100536, 403961, 282133, 100052496
    Gene Symbol and Synonyms A1-AR,A1AR,A1R,AA1R,ADORA1,ARA1,RDC7,Ri
    Uniprot Accession P30542
    Uniprot Entry Name AA1R_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000163485
    Target Classification Not Available

    The protein encoded by this gene is an adenosine receptor that belongs to the G-protein coupled receptor 1 family. There are 3 types of adenosine receptors, each with a specific pattern of ligand binding and tissue distribution, and together they regulate a diverse set of physiologic functions. The type A1 receptors inhibit adenylyl cyclase, and play a role in the fertilization process. Animal studies also suggest a role for A1 receptors in kidney function and ethanol intoxication. Transcript variants with alternative splicing in the 5' UTR have been found for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.