Human ADORA1/RDC7 ORF/cDNA clone-Lentivirus particle (BC026340)
Pre-made Human ADORA1/RDC7 Lentiviral expression plasmid for ADORA1 lentivirus packaging, ADORA1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to ADORA1/RDC7 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004056 | Human ADORA1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004056 |
Gene Name | ADORA1 |
Accession Number | BC026340 |
Gene ID | 134 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 981 bp |
Gene Alias | RDC7 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCCGCCCTCCATCTCAGCTTTCCAGGCCGCCTACATCGGCATCGAGGTGCTCATCGCCCTGGTCTCTGTGCCCGGGAACGTGCTGGTGATCTGGGCGGTGAAGGTGAACCAGGCGCTGCGGGATTCCACCTTCTGCTTCATCGTGCCGCTGGCGGTGGCTGATGTGGCCGTGGGTGCCCTGGTCATCCCCCTCGCCATCCTCATCAACATTGGGCCACAGACCTACTTCCACACCTGCCTCATGGTTGCCTGTCCGGTCCTCATCCTCACCCAGAGCTCCATCCTGGCCCTGCTGGCAATTGCTGTGGACCACTACCTCCGGGTCAAGATCCCTCTCCGGTACAAGATGGTGGTGACCCCCCGGAGGGCGGCGGTGGCCATAGCCGGCTGCTGGATCCTCTCCTTCGTGGTGGGACTGACCCCTATGTTTGGCTGGAACAATCTGAGTGCGGTGGAGCGGGCCTGGGCAGCCAACGGCAGCATGGGGGAGCCCGTGATCAAGTGCGAGTTCGAGAAGGTCATCAGCATGGAGTACATGGTCTACTTCAACTTCTTTGTGTGGGTGCTGCCCCCGCTTCTCCTCATGGTCCTCATCTACCTGGAGGTCTTCTACCTAATCCGCAAGCAGCTCAACAAGAAGGTGTCGGCCTCCTCCGGCGACCCGCAGAAGTACTATGGGAAGGAGCTGAAGATCGCCAAGTCGCTGGCCCTCATCCTCTTCCTCTTTGCCCTCAGCTGGCTGCCTTTGCACATCCTCAACTGCATCACCCTCTTCTGCCAGTCCTGCCACAAGCCCAGCATCCTTACCTACATTGCCATCTTCCTCACGCACGGCAACTCGGCCATGAACCCCATTGTCTATGCCTTCCGCATCCAGAAGTTCCGCGTCACCTTCCTTAAGATTTGGAATGACCATTTCCGCTGCCAGCCTGCACCTCCCATTGACGAGGATCTCCCAGAAGAGAGGCCTGATGACTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T92072-Ab | Anti-AA1R/ ADORA1/ RDC7 monoclonal antibody |
Target Antigen | GM-Tg-g-T92072-Ag | ADORA1 VLP (virus-like particle) |
ORF Viral Vector | pGMLP002707 | Human ADORA1 Lentivirus plasmid |
ORF Viral Vector | pGMLP004056 | Human ADORA1 Lentivirus plasmid |
ORF Viral Vector | vGMLP002707 | Human ADORA1 Lentivirus particle |
ORF Viral Vector | vGMLP004056 | Human ADORA1 Lentivirus particle |
Target information
Target ID | GM-T92072 |
Target Name | ADORA1 |
Gene ID | 134, 11539, 703638, 29290, 101100536, 403961, 282133, 100052496 |
Gene Symbol and Synonyms | A1-AR,A1AR,A1R,AA1R,ADORA1,ARA1,RDC7,Ri |
Uniprot Accession | P30542 |
Uniprot Entry Name | AA1R_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000163485 |
Target Classification | Not Available |
The protein encoded by this gene is an adenosine receptor that belongs to the G-protein coupled receptor 1 family. There are 3 types of adenosine receptors, each with a specific pattern of ligand binding and tissue distribution, and together they regulate a diverse set of physiologic functions. The type A1 receptors inhibit adenylyl cyclase, and play a role in the fertilization process. Animal studies also suggest a role for A1 receptors in kidney function and ethanol intoxication. Transcript variants with alternative splicing in the 5' UTR have been found for this gene. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.