Human CD28/Tp44 ORF/cDNA clone-Lentivirus particle (NM_006139)
Pre-made Human CD28/Tp44 Lentiviral expression plasmid for CD28 lentivirus packaging, CD28 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to CD28/Tp44 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002973 | Human CD28 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002973 |
Gene Name | CD28 |
Accession Number | NM_006139 |
Gene ID | 940 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 663 bp |
Gene Alias | Tp44 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCTCAGGCTGCTCTTGGCTCTCAACTTATTCCCTTCAATTCAAGTAACAGGAAACAAGATTTTGGTGAAGCAGTCGCCCATGCTTGTAGCGTACGACAATGCGGTCAACCTTAGCTGCAAGTATTCCTACAATCTCTTCTCAAGGGAGTTCCGGGCATCCCTTCACAAAGGACTGGATAGTGCTGTGGAAGTCTGTGTTGTATATGGGAATTACTCCCAGCAGCTTCAGGTTTACTCAAAAACGGGGTTCAACTGTGATGGGAAATTGGGCAATGAATCAGTGACATTCTACCTCCAGAATTTGTATGTTAACCAAACAGATATTTACTTCTGCAAAATTGAAGTTATGTATCCTCCTCCTTACCTAGACAATGAGAAGAGCAATGGAACCATTATCCATGTGAAAGGGAAACACCTTTGTCCAAGTCCCCTATTTCCCGGACCTTCTAAGCCCTTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTATTTTCTGGGTGAGGAGTAAGAGGAGCAGGCTCCTGCACAGTGACTACATGAACATGACTCCCCGCCGCCCCGGGCCCACCCGCAAGCATTACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCTATCGCTCCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-326 | Pre-Made Lulizumab biosimilar, Single Domain Variable Fragment;L, Anti-CD28 Antibody: Anti-Tp44 therapeutic antibody |
Biosimilar | GMP-Bios-INN-715 | Pre-Made Acazicolcept Biosimilar, Fusion Protein targeting CD28 fused with human IGHG1 Fc (Fragment constant) via a peptidyl linker: Recombinant therapeutic protein targeting Tp44 |
Biosimilar | GMP-Bios-INN-901 | |
Target Antibody | GM-Tg-g-T85529-Ab | Anti-CD28/ Tp44 monoclonal antibody |
Target Antigen | GM-Tg-g-T85529-Ag | CD28 VLP (virus-like particle) |
ORF Viral Vector | pGMLP002973 | Human CD28 Lentivirus plasmid |
ORF Viral Vector | vGMLP002973 | Human CD28 Lentivirus particle |
Target information
Target ID | GM-T85529 |
Target Name | CD28 |
Gene ID | 940, 12487, 705313, 25660, 493802, 403646, 281050, 100067829 |
Gene Symbol and Synonyms | CD28,CD28RNA,Tp44 |
Uniprot Accession | P10747 |
Uniprot Entry Name | CD28_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target, INN Index |
Disease | Cancer |
Gene Ensembl | ENSG00000178562 |
Target Classification | Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA) |
The protein encoded by this gene is essential for T-cell proliferation and survival, cytokine production, and T-helper type-2 development. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.