Human HMOX1/bK286B10/ HMOX1D ORF/cDNA clone-Lentivirus particle (NM_002133)

Pre-made Human HMOX1/bK286B10/ HMOX1D Lentiviral expression plasmid for HMOX1 lentivirus packaging, HMOX1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to HMOX1/bK286B10 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003511 Human HMOX1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003511
Gene Name HMOX1
Accession Number NM_002133
Gene ID 3162
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 867 bp
Gene Alias bK286B10, HMOX1D, HO-1, HSP32
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAGCGTCCGCAACCCGACAGCATGCCCCAGGATTTGTCAGAGGCCCTGAAGGAGGCCACCAAGGAGGTGCACACCCAGGCAGAGAATGCTGAGTTCATGAGGAACTTTCAGAAGGGCCAGGTGACCCGAGACGGCTTCAAGCTGGTGATGGCCTCCCTGTACCACATCTATGTGGCCCTGGAGGAGGAGATTGAGCGCAACAAGGAGAGCCCAGTCTTCGCCCCTGTCTACTTCCCAGAAGAGCTGCACCGCAAGGCTGCCCTGGAGCAGGACCTGGCCTTCTGGTACGGGCCCCGCTGGCAGGAGGTCATCCCCTACACACCAGCCATGCAGCGCTATGTGAAGCGGCTCCACGAGGTGGGGCGCACAGAGCCCGAGCTGCTGGTGGCCCACGCCTACACCCGCTACCTGGGTGACCTGTCTGGGGGCCAGGTGCTCAAAAAGATTGCCCAGAAAGCCCTGGACCTGCCCAGCTCTGGCGAGGGCCTGGCCTTCTTCACCTTCCCCAACATTGCCAGTGCCACCAAGTTCAAGCAGCTCTACCGCTCCCGCATGAACTCCCTGGAGATGACTCCCGCAGTCAGGCAGAGGGTGATAGAAGAGGCCAAGACTGCGTTCCTGCTCAACATCCAGCTCTTTGAGGAGTTGCAGGAGCTGCTGACCCATGACACCAAGGACCAGAGCCCCTCACGGGCACCAGGGCTTCGCCAGCGGGCCAGCAACAAAGTGCAAGATTCTGCCCCCGTGGAGACTCCCAGAGGGAAGCCCCCACTCAACACCCGCTCCCAGGCTCCGCTTCTCCGATGGGTCCTTACACTCAGCTTTCTGGTGGCGACAGTTGCTGTAGGGCTTTATGCCATGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0044-Ab Anti-HMOX1 monoclonal antibody
    Target Antigen GM-Tg-g-IP0044-Ag HMOX1 protein
    ORF Viral Vector pGMLV000302 Human HMOX1 Lentivirus plasmid
    ORF Viral Vector pGMLV000303 Human HMOX1 Lentivirus plasmid
    ORF Viral Vector pGMLV000774 Human HMOX1 Lentivirus plasmid
    ORF Viral Vector pGMLV001636 Rat Hmox1 Lentivirus plasmid
    ORF Viral Vector pGMAD000251 Rat Hmox1 Adenovirus plasmid
    ORF Viral Vector pGMAAV000324 Rat Hmox1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV000457 Rat Hmox1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMPC001181 Human HMOX1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP003511 Human HMOX1 Lentivirus plasmid
    ORF Viral Vector vGMLV000302 Human HMOX1 Lentivirus particle
    ORF Viral Vector vGMLV000303 Human HMOX1 Lentivirus particle
    ORF Viral Vector vGMLV000774 Human HMOX1 Lentivirus particle
    ORF Viral Vector vGMLV001636 Rat Hmox1 Lentivirus particle
    ORF Viral Vector vGMAD000251 Rat Hmox1 Adenovirus particle
    ORF Viral Vector vGMAAV000324 Rat Hmox1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV000457 Rat Hmox1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP003511 Human HMOX1 Lentivirus particle
    ORF Viral Vector pGMLV002479 Mouse Hmox1 Lentivirus plasmid
    ORF Viral Vector pGMLV002552 Human HMOX1 Lentivirus plasmid


    Target information

    Target ID GM-IP0044
    Target Name HMOX1
    Gene ID 3162, 15368, 719266, 24451, 101092621, 442987, 513221, 100069058
    Gene Symbol and Synonyms bK286B10,D8Wsu38e,Hemox,Heox,HEOXG,Hmox,HMOX1,HMOX1D,HO-1,HO1,HSP32
    Uniprot Accession P09601
    Uniprot Entry Name HMOX1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Acute kidney failure, Renal tubulo-interstitial diseases
    Gene Ensembl ENSG00000100292
    Target Classification Not Available

    Heme oxygenase, an essential enzyme in heme catabolism, cleaves heme to form biliverdin, which is subsequently converted to bilirubin by biliverdin reductase, and carbon monoxide, a putative neurotransmitter. Heme oxygenase activity is induced by its substrate heme and by various nonheme substances. Heme oxygenase occurs as 2 isozymes, an inducible heme oxygenase-1 and a constitutive heme oxygenase-2. HMOX1 and HMOX2 belong to the heme oxygenase family. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.