Human DFFB/CAD/CPAN ORF/cDNA clone-Lentivirus particle (NM_004402)

Cat. No.: vGMLP003552

Pre-made Human DFFB/CAD/CPAN Lentiviral expression plasmid for DFFB lentivirus packaging, DFFB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to DFFB/CAD products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003552 Human DFFB Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003552
Gene Name DFFB
Accession Number NM_004402
Gene ID 1677
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1017 bp
Gene Alias CAD,CPAN,DFF-40,DFF2,DFF40
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTCCAGAAGCCCAAGAGCGTGAAGCTGCGGGCCCTGCGCAGCCCGAGGAAGTTCGGCGTGGCTGGCCGGAGCTGCCAGGAGGTGCTGCGCAAGGGCTGTCTCCGCTTCCAGCTCCCTGAGCGCGGTTCCCGGCTGTGCCTGTACGAGGATGGCACGGAGCTGACGGAAGATTACTTCCCCAGTGTTCCCGACAACGCCGAGCTGGTGCTGCTCACCTTGGGCCAGGCCTGGCAGGGCTATGTGAGCGACATCAGGCGCTTCCTCAGTGCATTTCACGAGCCACAGGTGGGGCTCATCCAGGCCGCCCAGCAGCTGCTGTGTGATGAGCAGGCCCCACAGAGGCAGAGGCTGCTGGCTGACCTCCTGCACAACGTCAGCCAGAACATCGCGGCCGAGACCCGGGCTGAGGACCCGCCGTGGTTTGAAGGCTTGGAGTCCCGATTTCAGAGCAAGTCTGGCTATCTGAGATACAGCTGTGAGAGCCGGATCCGGAGTTACCTGAGGGAGGTGAGCTCCTACCCCTCCACGGTGGGTGCGGAGGCTCAGGAGGAATTCCTGCGGGTCCTCGGCTCCATGTGCCAGAGGCTCCGGTCCATGCAGTACAATGGCAGCTACTTCGACAGAGGAGCCAAGGGCGGCAGCCGCCTCTGCACACCGGAAGGCTGGTTCTCCTGCCAGGGTCCCTTTGACATGGACAGCTGCTTATCAAGACACTCCATCAACCCCTACAGTAACAGGGAGAGCAGGATCCTCTTCAGCACCTGGAACCTGGATCACATAATAGAAAAGAAACGCACCATCATTCCTACACTGGTGGAAGCAATTAAGGAACAAGATGGAAGAGAAGTGGACTGGGAGTATTTTTATGGCCTGCTTTTTACCTCAGAGAACCTAAAACTAGTGCACATTGTCTGCCATAAGAAAACCACCCACAAGCTCAACTGTGACCCAAGCAGAATCTACAAACCCCAGACAAGGTTGAAGCGGAAGCAGCCTGTGCGGAAACGCCAGTGA
ORF Protein Sequence MLQKPKSVKLRALRSPRKFGVAGRSCQEVLRKGCLRFQLPERGSRLCLYEDGTELTEDYFPSVPDNAELVLLTLGQAWQGYVSDIRRFLSAFHEPQVGLIQAAQQLLCDEQAPQRQRLLADLLHNVSQNIAAETRAEDPPWFEGLESRFQSKSGYLRYSCESRIRSYLREVSSYPSTVGAEAQEEFLRVLGSMCQRLRSMQYNGSYFDRGAKGGSRLCTPEGWFSCQGPFDMDSCLSRHSINPYSNRESRILFSTWNLDHIIEKKRTIIPTLVEAIKEQDGREVDWEYFYGLLFTSENLKLVHIVCHKKTTHKLNCDPSRIYKPQTRLKRKQPVRKRQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T91020-Ab Anti-DFFB monoclonal antibody
    Target Antigen GM-Tg-g-T91020-Ag DFFB protein
    ORF Viral Vector pGMLP003552 Human DFFB Lentivirus plasmid
    ORF Viral Vector vGMLP003552 Human DFFB Lentivirus particle


    Target information

    Target ID GM-T91020
    Target Name DFFB
    Gene ID 1677, 13368, 722487, 84359, 101092127, 489623, 512730, 100060427
    Gene Symbol and Synonyms 40kDa,5730477D02Rik,CAD,CPAN,DFF-40,DFF2,DFF40,DFFB,Didff
    Uniprot Accession O76075
    Uniprot Entry Name DFFB_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000169598
    Target Classification Not Available

    Apoptosis is a cell death process that removes toxic and/or useless cells during mammalian development. The apoptotic process is accompanied by shrinkage and fragmentation of the cells and nuclei and degradation of the chromosomal DNA into nucleosomal units. DNA fragmentation factor (DFF) is a heterodimeric protein of 40-kD (DFFB) and 45-kD (DFFA) subunits. DFFA is the substrate for caspase-3 and triggers DNA fragmentation during apoptosis. DFF becomes activated when DFFA is cleaved by caspase-3. The cleaved fragments of DFFA dissociate from DFFB, the active component of DFF. DFFB has been found to trigger both DNA fragmentation and chromatin condensation during apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene but the biological validity of some of these variants has not been determined. [provided by RefSeq, Sep 2013]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.