Human IL10RB/CDW210B/ CRF2-4 ORF/cDNA clone-Lentivirus particle (NM_000628)
Pre-made Human IL10RB/CDW210B/ CRF2-4 Lentiviral expression plasmid for IL10RB lentivirus packaging, IL10RB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to IL10RB/CDW210B products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004604 | Human IL10RB Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004604 |
Gene Name | IL10RB |
Accession Number | NM_000628 |
Gene ID | 3588 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 978 bp |
Gene Alias | CDW210B, CRF2-4, CRFB4, D21S58, D21S66, IL-10R2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCGTGGAGCCTTGGGAGCTGGCTGGGTGGCTGCCTGCTGGTGTCAGCATTGGGAATGGTACCACCTCCCGAAAATGTCAGAATGAATTCTGTTAATTTCAAGAACATTCTACAGTGGGAGTCACCTGCTTTTGCCAAAGGGAACCTGACTTTCACAGCTCAGTACCTAAGTTATAGGATATTCCAAGATAAATGCATGAATACTACCTTGACGGAATGTGATTTCTCAAGTCTTTCCAAGTATGGTGACCACACCTTGAGAGTCAGGGCTGAATTTGCAGATGAGCATTCAGACTGGGTAAACATCACCTTCTGTCCTGTGGATGACACCATTATTGGACCCCCTGGAATGCAAGTAGAAGTACTTGCTGATTCTTTACATATGCGTTTCTTAGCCCCTAAAATTGAGAATGAATACGAAACTTGGACTATGAAGAATGTGTATAACTCATGGACTTATAATGTGCAATACTGGAAAAACGGTACTGATGAAAAGTTTCAAATTACTCCCCAGTATGACTTTGAGGTCCTCAGAAACCTGGAGCCATGGACAACTTATTGTGTTCAAGTTCGAGGGTTTCTTCCTGATCGGAACAAAGCTGGGGAATGGAGTGAGCCTGTCTGTGAGCAAACAACCCATGACGAAACGGTCCCCTCCTGGATGGTGGCCGTCATCCTCATGGCCTCGGTCTTCATGGTCTGCCTGGCACTCCTCGGCTGCTTCGCCTTGCTGTGGTGCGTTTACAAGAAGACAAAGTACGCCTTCTCCCCTAGGAATTCTCTTCCACAGCACCTGAAAGAGTTTTTGGGCCATCCTCATCATAACACACTTCTGTTTTTCTCCTTTCCATTGTCGGATGAGAATGATGTTTTTGACAAGCTAAGTGTCATTGCAGAAGACTCTGAGAGCGGCAAGCAGAATCCTGGTGACAGCTGCAGCCTCGGGACCCCGCCTGGGCAGGGGCCCCAAAGCTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-INN-819 | Pre-Made Eflepedocokin Alfa Biosimilar, Fusion Protein targeting IL10RB fused with human IGHG2 Fc (Fragment constant) via a peptidyl linker: Recombinant therapeutic protein targeting CDW210B/CRF2-4/CRFB4/D21S58/D21S66/IL-10R2 |
Target Antibody | GM-Tg-g-T14557-Ab | Anti-I10R2/ IL10RB/ CDW210B monoclonal antibody |
Target Antigen | GM-Tg-g-T14557-Ag | IL10RB VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-T14557 | interleukin 10 receptor, beta (IL10RB) protein & antibody |
ORF Viral Vector | pGMLP004604 | Human IL10RB Lentivirus plasmid |
ORF Viral Vector | vGMLP004604 | Human IL10RB Lentivirus particle |
Target information
Target ID | GM-T14557 |
Target Name | IL10RB |
Gene ID | 3588, 16155, 706012, 304091, 101090038, 478404, 767864, 100052549 |
Gene Symbol and Synonyms | 6620401D04Rik,CDW210B,CRF2-4,CRFB4,D16H21S58,D21S58,D21S58h,D21S66,IBD25,IL-10R2,IL-10RB,Il10r2,IL10RB,RGD1560373 |
Uniprot Accession | Q08334 |
Uniprot Entry Name | I10R2_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, INN Index, Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000243646 |
Target Classification | Not Available |
The protein encoded by this gene belongs to the cytokine receptor family. It is an accessory chain essential for the active interleukin 10 receptor complex. Coexpression of this and IL10RA proteins has been shown to be required for IL10-induced signal transduction. This gene and three other interferon receptor genes, IFAR2, IFNAR1, and IFNGR2, form a class II cytokine receptor gene cluster located in a small region on chromosome 21. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.