Human IL10RB/CDW210B/ CRF2-4 ORF/cDNA clone-Lentivirus particle (NM_000628)

Pre-made Human IL10RB/CDW210B/ CRF2-4 Lentiviral expression plasmid for IL10RB lentivirus packaging, IL10RB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to IL10RB/CDW210B products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004604 Human IL10RB Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004604
Gene Name IL10RB
Accession Number NM_000628
Gene ID 3588
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 978 bp
Gene Alias CDW210B, CRF2-4, CRFB4, D21S58, D21S66, IL-10R2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCGTGGAGCCTTGGGAGCTGGCTGGGTGGCTGCCTGCTGGTGTCAGCATTGGGAATGGTACCACCTCCCGAAAATGTCAGAATGAATTCTGTTAATTTCAAGAACATTCTACAGTGGGAGTCACCTGCTTTTGCCAAAGGGAACCTGACTTTCACAGCTCAGTACCTAAGTTATAGGATATTCCAAGATAAATGCATGAATACTACCTTGACGGAATGTGATTTCTCAAGTCTTTCCAAGTATGGTGACCACACCTTGAGAGTCAGGGCTGAATTTGCAGATGAGCATTCAGACTGGGTAAACATCACCTTCTGTCCTGTGGATGACACCATTATTGGACCCCCTGGAATGCAAGTAGAAGTACTTGCTGATTCTTTACATATGCGTTTCTTAGCCCCTAAAATTGAGAATGAATACGAAACTTGGACTATGAAGAATGTGTATAACTCATGGACTTATAATGTGCAATACTGGAAAAACGGTACTGATGAAAAGTTTCAAATTACTCCCCAGTATGACTTTGAGGTCCTCAGAAACCTGGAGCCATGGACAACTTATTGTGTTCAAGTTCGAGGGTTTCTTCCTGATCGGAACAAAGCTGGGGAATGGAGTGAGCCTGTCTGTGAGCAAACAACCCATGACGAAACGGTCCCCTCCTGGATGGTGGCCGTCATCCTCATGGCCTCGGTCTTCATGGTCTGCCTGGCACTCCTCGGCTGCTTCGCCTTGCTGTGGTGCGTTTACAAGAAGACAAAGTACGCCTTCTCCCCTAGGAATTCTCTTCCACAGCACCTGAAAGAGTTTTTGGGCCATCCTCATCATAACACACTTCTGTTTTTCTCCTTTCCATTGTCGGATGAGAATGATGTTTTTGACAAGCTAAGTGTCATTGCAGAAGACTCTGAGAGCGGCAAGCAGAATCCTGGTGACAGCTGCAGCCTCGGGACCCCGCCTGGGCAGGGGCCCCAAAGCTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-819 Pre-Made Eflepedocokin Alfa Biosimilar, Fusion Protein targeting IL10RB fused with human IGHG2 Fc (Fragment constant) via a peptidyl linker: Recombinant therapeutic protein targeting CDW210B/CRF2-4/CRFB4/D21S58/D21S66/IL-10R2
    Target Antibody GM-Tg-g-T14557-Ab Anti-I10R2/ IL10RB/ CDW210B monoclonal antibody
    Target Antigen GM-Tg-g-T14557-Ag IL10RB VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T14557 interleukin 10 receptor, beta (IL10RB) protein & antibody
    ORF Viral Vector pGMLP004604 Human IL10RB Lentivirus plasmid
    ORF Viral Vector vGMLP004604 Human IL10RB Lentivirus particle


    Target information

    Target ID GM-T14557
    Target Name IL10RB
    Gene ID 3588, 16155, 706012, 304091, 101090038, 478404, 767864, 100052549
    Gene Symbol and Synonyms 6620401D04Rik,CDW210B,CRF2-4,CRFB4,D16H21S58,D21S58,D21S58h,D21S66,IBD25,IL-10R2,IL-10RB,Il10r2,IL10RB,RGD1560373
    Uniprot Accession Q08334
    Uniprot Entry Name I10R2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000243646
    Target Classification Not Available

    The protein encoded by this gene belongs to the cytokine receptor family. It is an accessory chain essential for the active interleukin 10 receptor complex. Coexpression of this and IL10RA proteins has been shown to be required for IL10-induced signal transduction. This gene and three other interferon receptor genes, IFAR2, IFNAR1, and IFNGR2, form a class II cytokine receptor gene cluster located in a small region on chromosome 21. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.