Human TSPAN7/A15/CCG-B7 ORF/cDNA clone-Lentivirus particle (NM_004615)

Cat. No.: vGMLP004683

Pre-made Human TSPAN7/A15/CCG-B7 Lentiviral expression plasmid for TSPAN7 lentivirus packaging, TSPAN7 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to TSPAN7/A15 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004683 Human TSPAN7 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004683
Gene Name TSPAN7
Accession Number NM_004615
Gene ID 7102
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 750 bp
Gene Alias A15,CCG-B7,CD231,DXS1692E,MRX58,MXS1,TALLA-1,TM4SF2,TM4SF2b
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCATCGAGGAGAATGGAGACCAAACCTGTGATAACCTGTCTCAAAACCCTCCTCATCATCTACTCCTTCGTCTTCTGGATCACTGGGGTGATCCTGCTGGCTGTTGGAGTCTGGGGCAAACTTACTCTGGGCACCTATATCTCCCTTATTGCCGAGAACTCCACAAATGCTCCCTATGTGCTCATCGGAACTGGCACCACTATTGTTGTCTTTGGCCTGTTTGGATGCTTTGCTACATGTCGTGGTAGCCCATGGATGCTGAAACTGTATGCCATGTTTCTGTCCCTGGTGTTCCTGGCTGAGCTCGTAGCTGGCATTTCAGGGTTTGTGTTTCGTCATGAGATCAAGGACACCTTCCTGAGGACTTACACGGACGCTATGCAGACTTACAATGGCAATGATGAGAGGAGCCGGGCAGTGGACCATGTGCAGCGCAGCCTGAGCTGCTGTGGTGTGCAGAACTACACCAACTGGAGCACCAGCCCCTACTTCCTGGAGCATGGCATCCCCCCCAGCTGCTGCATGAACGAAACTGATTGTAATCCCCAGGATCTACACAATCTGACTGTGGCCGCCACCAAAGTTAACCAGAAGGGTTGTTATGATCTGGTAACTAGTTTCATGGAGACTAACATGGGAATCATCGCTGGAGTGGCGTTTGGAATCGCATTCTCCCAGTTAATTGGCATGCTGCTGGCCTGCTGTCTGTCCCGGTTCATCACGGCCAATCAGTATGAGATGGTGTAA
ORF Protein Sequence MASRRMETKPVITCLKTLLIIYSFVFWITGVILLAVGVWGKLTLGTYISLIAENSTNAPYVLIGTGTTIVVFGLFGCFATCRGSPWMLKLYAMFLSLVFLAELVAGISGFVFRHEIKDTFLRTYTDAMQTYNGNDERSRAVDHVQRSLSCCGVQNYTNWSTSPYFLEHGIPPSCCMNETDCNPQDLHNLTVAATKVNQKGCYDLVTSFMETNMGIIAGVAFGIAFSQLIGMLLACCLSRFITANQYEMV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0183-Ab Anti-TSPAN7 monoclonal antibody
    Target Antigen GM-Tg-g-IP0183-Ag TSPAN7 protein
    ORF Viral Vector pGMLP004683 Human TSPAN7 Lentivirus plasmid
    ORF Viral Vector vGMLP004683 Human TSPAN7 Lentivirus particle


    Target information

    Target ID GM-IP0183
    Target Name TSPAN7
    Gene ID 7102, 21912, 698011, 363447, 101088058, 480879, 615596, 100055873
    Gene Symbol and Synonyms 1200014P11Rik,A15,CCG-B7,CD231,DXS1692E,MRX58,MXS1,PE31,TALLA,TALLA-1,TM4SF2,TM4SF2b,TSPAN7,XLID58
    Uniprot Accession P41732
    Uniprot Entry Name TSN7_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000156298
    Target Classification Not Available

    The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein and may have a role in the control of neurite outgrowth. It is known to complex with integrins. This gene is associated with X-linked cognitive disability and neuropsychiatric diseases such as Huntington's chorea, fragile X syndrome and myotonic dystrophy. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.