Human SNAP25/bA416N4.2/ CMS18 ORF/cDNA clone-Lentivirus particle (NM_001322907)

Pre-made Human SNAP25/bA416N4.2/ CMS18 Lentiviral expression plasmid for SNAP25 lentivirus packaging, SNAP25 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to SNAP25/bA416N4.2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004868 Human SNAP25 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004868
Gene Name SNAP25
Accession Number NM_001322907
Gene ID 6616
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 621 bp
Gene Alias bA416N4.2, CMS18, dJ1068F16.2, RIC-4, RIC4, SEC9, SNAP, SNAP-25, SUP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCCGAAGACGCAGACATGCGCAATGAGCTGGAGGAGATGCAGCGAAGGGCTGACCAGTTGGCTGATGAGTCGCTGGAAAGCACCCGTCGTATGCTGCAACTGGTTGAAGAGAGTAAAGATGCTGGTATCAGGACTTTGGTTATGTTGGATGAACAAGGAGAACAACTGGAACGCATTGAGGAAGGGATGGACCAAATCAATAAGGACATGAAAGAAGCAGAAAAGAATTTGACGGACCTAGGAAAATTCTGCGGGCTTTGTGTGTGTCCCTGTAACAAGCTTAAATCAAGTGATGCTTACAAAAAAGCCTGGGGCAATAATCAGGACGGAGTGGTGGCCAGCCAGCCTGCTCGTGTAGTGGACGAACGGGAGCAGATGGCCATCAGTGGCGGCTTCATCCGCAGGGTAACAAATGATGCCCGAGAAAATGAAATGGATGAAAACCTAGAGCAGGTGAGCGGCATCATCGGGAACCTCCGTCACATGGCCCTGGATATGGGCAATGAGATCGATACACAGAATCGCCAGATCGACAGGATCATGGAGAAGGCTGATTCCAACAAAACCAGAATTGATGAGGCCAACCAACGTGCAACAAAGATGCTGGGAAGTGGTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T71023-Ab Anti-SNP25/ SNAP25/ CMS18 monoclonal antibody
    Target Antigen GM-Tg-g-T71023-Ag SNAP25 VLP (virus-like particle)
    ORF Viral Vector pGMLV001735 Human SNAP25 Lentivirus plasmid
    ORF Viral Vector pGMLP004868 Human SNAP25 Lentivirus plasmid
    ORF Viral Vector vGMLV001735 Human SNAP25 Lentivirus particle
    ORF Viral Vector vGMLP004868 Human SNAP25 Lentivirus particle


    Target information

    Target ID GM-T71023
    Target Name SNAP25
    Gene ID 6616, 20614, 574204, 25012, 101092511, 477158, 540853, 100051273
    Gene Symbol and Synonyms bA416N4.2,Bdr,CMS18,dJ1068F16.2,GENA70,RIC-4,RIC4,SEC9,SNAP,SNAP-25,SNAP-25a,SNAP-25B,SNAP25,sp,SUP
    Uniprot Accession P60880
    Uniprot Entry Name SNP25_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000132639
    Target Classification Not Available

    Synaptic vesicle membrane docking and fusion is mediated by SNAREs (soluble N-ethylmaleimide-sensitive factor attachment protein receptors) located on the vesicle membrane (v-SNAREs) and the target membrane (t-SNAREs). The assembled v-SNARE/t-SNARE complex consists of a bundle of four helices, one of which is supplied by v-SNARE and the other three by t-SNARE. For t-SNAREs on the plasma membrane, the protein syntaxin supplies one helix and the protein encoded by this gene contributes the other two. Therefore, this gene product is a presynaptic plasma membrane protein involved in the regulation of neurotransmitter release. Two alternative transcript variants encoding different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.