Human SNAP25/bA416N4.2/ CMS18 ORF/cDNA clone-Lentivirus particle (NM_003081)
Pre-made Human SNAP25/bA416N4.2/ CMS18 Lentiviral expression plasmid for SNAP25 lentivirus packaging, SNAP25 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to SNAP25/bA416N4.2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLV001735 | Human SNAP25 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLV001735 |
Gene Name | SNAP25 |
Accession Number | NM_003081 |
Gene ID | 6616 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 621 bp |
Gene Alias | bA416N4.2, CMS18, dJ1068F16.2, RIC-4, RIC4, SEC9, SNAP, SNAP-25, SUP |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocinmyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCCGAAGACGCAGACATGCGCAATGAGCTGGAGGAGATGCAGCGAAGGGCTGACCAGTTGGCTGATGAGTCGCTGGAAAGCACCCGTCGTATGCTGCAACTGGTTGAAGAGAGTAAAGATGCTGGTATCAGGACTTTGGTTATGTTGGATGAACAAGGAGAACAACTCGATCGTGTCGAAGAAGGCATGAACCATATCAACCAAGACATGAAGGAGGCTGAGAAAAATTTAAAAGATTTAGGGAAATGCTGTGGCCTTTTCATATGTCCTTGTAACAAGCTTAAATCAAGTGATGCTTACAAAAAAGCCTGGGGCAATAATCAGGACGGAGTGGTGGCCAGCCAGCCTGCTCGTGTAGTGGACGAACGGGAGCAGATGGCCATCAGTGGCGGCTTCATCCGCAGGGTAACAAATGATGCCCGAGAAAATGAAATGGATGAAAACCTAGAGCAGGTGAGCGGCATCATCGGGAACCTCCGTCACATGGCCCTGGATATGGGCAATGAGATCGATACACAGAATCGCCAGATCGACAGGATCATGGAGAAGGCTGATTCCAACAAAACCAGAATTGATGAGGCCAACCAACGTGCAACAAAGATGCTGGGAAGTGGTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T71023-Ab | Anti-SNP25/ SNAP25/ CMS18 monoclonal antibody |
Target Antigen | GM-Tg-g-T71023-Ag | SNAP25 VLP (virus-like particle) |
ORF Viral Vector | pGMLV001735 | Human SNAP25 Lentivirus plasmid |
ORF Viral Vector | pGMLP004868 | Human SNAP25 Lentivirus plasmid |
ORF Viral Vector | vGMLV001735 | Human SNAP25 Lentivirus particle |
ORF Viral Vector | vGMLP004868 | Human SNAP25 Lentivirus particle |
Target information
Target ID | GM-T71023 |
Target Name | SNAP25 |
Gene ID | 6616, 20614, 574204, 25012, 101092511, 477158, 540853, 100051273 |
Gene Symbol and Synonyms | bA416N4.2,Bdr,CMS18,dJ1068F16.2,GENA70,RIC-4,RIC4,SEC9,SNAP,SNAP-25,SNAP-25a,SNAP-25B,SNAP25,sp,SUP |
Uniprot Accession | P60880 |
Uniprot Entry Name | SNP25_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000132639 |
Target Classification | Not Available |
Synaptic vesicle membrane docking and fusion is mediated by SNAREs (soluble N-ethylmaleimide-sensitive factor attachment protein receptors) located on the vesicle membrane (v-SNAREs) and the target membrane (t-SNAREs). The assembled v-SNARE/t-SNARE complex consists of a bundle of four helices, one of which is supplied by v-SNARE and the other three by t-SNARE. For t-SNAREs on the plasma membrane, the protein syntaxin supplies one helix and the protein encoded by this gene contributes the other two. Therefore, this gene product is a presynaptic plasma membrane protein involved in the regulation of neurotransmitter release. Two alternative transcript variants encoding different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.