Human APOE/AD2/ APO-E ORF/cDNA clone-Lentivirus particle (NM_000041.3)
Pre-made Human APOE/AD2/ APO-E Lentiviral expression plasmid for APOE lentivirus packaging, APOE lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to APOE/AD2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLV001748 | Human APOE Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLV001748 |
Gene Name | APOE |
Accession Number | NM_000041.3 |
Gene ID | 348 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 954 bp |
Gene Alias | AD2, APO-E, ApoE4, LDLCQ5, LPG |
Fluorescent Reporter | mCherry |
Mammalian Cell Selection | Puromyocinmyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTGCGCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGGGATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGGCGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCGGAACTGGAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAAGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGTGCGGCCGCCTGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTGTGGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGCGCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCCAGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGCCCAGCGACAATCACTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T21689-Ab | Anti-APOE/ AD2/ APO-E monoclonal antibody |
Target Antigen | GM-Tg-g-T21689-Ag | APOE VLP (virus-like particle) |
ORF Viral Vector | pGMLV001748 | Human APOE Lentivirus plasmid |
ORF Viral Vector | pGMAAV000334 | Human APOE Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMLP001912 | Human APOE Lentivirus plasmid |
ORF Viral Vector | vGMLV001748 | Human APOE Lentivirus particle |
ORF Viral Vector | vGMAAV000334 | Human APOE Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMLP001912 | Human APOE Lentivirus particle |
ORF Viral Vector | pGMLV002187 | Mouse Apoe Lentivirus plasmid |
Target information
Target ID | GM-T21689 |
Target Name | APOE |
Gene ID | 348, 11816, 714623, 25728, 101086769, 476438, 281004, 100065481 |
Gene Symbol and Synonyms | AD2,APO-E,APOE,ApoE4,APOEA,LDLCQ5,LPG |
Uniprot Accession | P02649 |
Uniprot Entry Name | APOE_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Diagnostics Biomarker |
Disease | Type 1 diabetes mellitus, Alzheimer's Disease, Breast neoplasms, Dent disease, Malignant neoplasm of bladder, Other diseases of intestines (K55-K64) |
Gene Ensembl | ENSG00000130203 |
Target Classification | Not Available |
The protein encoded by this gene is a major apoprotein of the chylomicron. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. This gene maps to chromosome 19 in a cluster with the related apolipoprotein C1 and C2 genes. Mutations in this gene result in familial dysbetalipoproteinemia, or type III hyperlipoproteinemia (HLP III), in which increased plasma cholesterol and triglycerides are the consequence of impaired clearance of chylomicron and VLDL remnants. [provided by RefSeq, Jun 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.