Human CLDN1/CLD1/ILVASC ORF/cDNA clone-Lentivirus particle (NM_021101.5)
Cat. No.: vGMLV001928
Pre-made Human CLDN1/CLD1/ILVASC Lentiviral expression plasmid for CLDN1 lentivirus packaging, CLDN1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
CLDN1/CLD1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLV001928 | Human CLDN1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLV001928 |
Gene Name | CLDN1 |
Accession Number | NM_021101.5 |
Gene ID | 9076 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 636 bp |
Gene Alias | CLD1,ILVASC,SEMP1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCCAACGCGGGGCTGCAGCTGTTGGGCTTCATTCTCGCCTTCCTGGGATGGATCGGCGCCATCGTCAGCACTGCCCTGCCCCAGTGGAGGATTTACTCCTATGCCGGCGACAACATCGTGACCGCCCAGGCCATGTACGAGGGGCTGTGGATGTCCTGCGTGTCGCAGAGCACCGGGCAGATCCAGTGCAAAGTCTTTGACTCCTTGCTGAATCTGAGCAGCACATTGCAAGCAACCCGTGCCTTGATGGTGGTTGGCATCCTCCTGGGAGTGATAGCAATCTTTGTGGCCACCGTTGGCATGAAGTGTATGAAGTGCTTGGAAGACGATGAGGTGCAGAAGATGAGGATGGCTGTCATTGGGGGTGCGATATTTCTTCTTGCAGGTCTGGCTATTTTAGTTGCCACAGCATGGTATGGCAATAGAATCGTTCAAGAATTCTATGACCCTATGACCCCAGTCAATGCCAGGTACGAATTTGGTCAGGCTCTCTTCACTGGCTGGGCTGCTGCTTCTCTCTGCCTTCTGGGAGGTGCCCTACTTTGCTGTTCCTGTCCCCGAAAAACAACCTCTTACCCAACACCAAGGCCCTATCCAAAACCTGCACCTTCCAGCGGGAAAGACTACGTGTGA |
ORF Protein Sequence | MANAGLQLLGFILAFLGWIGAIVSTALPQWRIYSYAGDNIVTAQAMYEGLWMSCVSQSTGQIQCKVFDSLLNLSSTLQATRALMVVGILLGVIAIFVATVGMKCMKCLEDDEVQKMRMAVIGGAIFLLAGLAILVATAWYGNRIVQEFYDPMTPVNARYEFGQALFTGWAAASLCLLGGALLCCSCPRKTTSYPTPRPYPKPAPSSGKDYV |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0271-Ab | Anti-CLD1/ CLDN1/ ILVASC monoclonal antibody |
Target Antigen | GM-Tg-g-MP0271-Ag | CLDN1 VLP (virus-like particle) |
ORF Viral Vector | pGMLV000077 | Human CLDN1 Lentivirus plasmid |
ORF Viral Vector | pGMLV001928 | Human CLDN1 Lentivirus plasmid |
ORF Viral Vector | pGMPC000975 | Human CLDN1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLV000077 | Human CLDN1 Lentivirus particle |
ORF Viral Vector | vGMLV001928 | Human CLDN1 Lentivirus particle |
Target information
Target ID | GM-MP0271 |
Target Name | CLDN1 |
Gene ID | 9076, 12737, 704330, 65129, 101094619, 608207, 414922, 100059811 |
Gene Symbol and Synonyms | claudin-1,CLD1,CLDN1,ILVASC,SEMP1 |
Uniprot Accession | O95832 |
Uniprot Entry Name | CLD1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Cancer |
Gene Ensembl | ENSG00000163347 |
Target Classification | Tumor-associated antigen (TAA) |
Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. These junctions are comprised of sets of continuous networking strands in the outwardly facing cytoplasmic leaflet, with complementary grooves in the inwardly facing extracytoplasmic leaflet. The protein encoded by this gene, a member of the claudin family, is an integral membrane protein and a component of tight junction strands. Loss of function mutations result in neonatal ichthyosis-sclerosing cholangitis syndrome. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.