Human MAPK8/JNK/JNK-46 ORF/cDNA clone-Adenovirus plasmid (NM_001323302.1)

Cat. No.: pGMAP-SPh-196
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MAPK8/JNK/JNK-46 adenoviral expression plasmid for MAPK8 adenovirus packaging, MAPK8 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.


Target products collection

Go to JNK1/MAPK8/JNK products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP-SPh-196
Gene Name MAPK8
Accession Number NM_001323302.1
Gene ID 5599
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 1155 bp
Gene Alias JNK,JNK-46,JNK1,JNK1A2,JNK21B1/2,PRKM8,SAPK1,SAPK1c
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGAGCAGAAGCAAGCGTGACAACAATTTTTATAGTGTAGAGATTGGAGATTCTACATTCACAGTCCTGAAACGATATCAGAATTTAAAACCTATAGGCTCAGGAGCTCAAGGAATAGTATGCGCAGCTTATGATGCCATTCTTGAAAGAAATGTTGCAATCAAGAAGCTAAGCCGACCATTTCAGAATCAGACTCATGCCAAGCGGGCCTACAGAGAGCTAGTTCTTATGAAATGTGTTAATCACAAAAATATAATTGGCCTTTTGAATGTTTTCACACCACAGAAATCCCTAGAAGAATTTCAAGATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTTTGCCAAGTGATTCAGATGGAGCTAGATCATGAAAGAATGTCCTACCTTCTCTATCAGATGCTGTGTGGAATCAAGCACCTTCATTCTGCTGGAATTATTCATCGGGACTTAAAGCCCAGTAATATAGTAGTAAAATCTGATTGCACTTTGAAGATTCTTGACTTCGGTCTGGCCAGGACTGCAGGAACGAGTTTTATGATGACGCCTTATGTAGTGACTCGCTACTACAGAGCACCCGAGGTCATCCTTGGCATGGGCTACAAGGAAAACGTGGATTTATGGTCTGTGGGGTGCATTATGGGAGAAATGGTTTGCCACAAAATCCTCTTTCCAGGAAGGGACTATATTGATCAGTGGAATAAAGTTATTGAACAGCTTGGAACACCATGTCCTGAATTCATGAAGAAACTGCAACCAACAGTAAGGACTTACGTTGAAAACAGACCTAAATATGCTGGATATAGCTTTGAGAAACTCTTCCCTGATGTCCTTTTCCCAGCTGACTCAGAACACAACAAACTTAAAGCCAGTCAGGCAAGGGATTTGTTATCCAAAATGCTGGTAATAGATGCATCTAAAAGGATCTCTGTAGATGAAGCTCTCCAACACCCGTACATCAATGTCTGGTATGATCCTTCTGAAGCAGAAGCTCCACCACCAAAGATCCCTGACAAGCAGTTAGATGAAAGGGAACACACAATAGAAGAGTGGAAAGAATTGATATATAAGGAAGTTATGGACTTGGAGGAGAGAACCAAGAATGGAGTTATACGGGGGCAGCCCTCTCCTTTAGCACAGGTGCAGCAGTGA
ORF Protein Sequence MSRSKRDNNFYSVEIGDSTFTVLKRYQNLKPIGSGAQGIVCAAYDAILERNVAIKKLSRPFQNQTHAKRAYRELVLMKCVNHKNIIGLLNVFTPQKSLEEFQDVYIVMELMDANLCQVIQMELDHERMSYLLYQMLCGIKHLHSAGIIHRDLKPSNIVVKSDCTLKILDFGLARTAGTSFMMTPYVVTRYYRAPEVILGMGYKENVDLWSVGCIMGEMVCHKILFPGRDYIDQWNKVIEQLGTPCPEFMKKLQPTVRTYVENRPKYAGYSFEKLFPDVLFPADSEHNKLKASQARDLLSKMLVIDASKRISVDEALQHPYINVWYDPSEAEAPPPKIPDKQLDEREHTIEEWKELIYKEVMDLEERTKNGVIRGQPSPLAQVQQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T40097-Ab Anti-JNK1 monoclonal antibody
    Target Antigen GM-Tg-g-T40097-Ag JNK1/MAPK8 protein
    ORF Viral Vector pGMLP005225 Human MAPK8 Lentivirus plasmid
    ORF Viral Vector pGMAD000121 Human MAPK8 Adenovirus plasmid
    ORF Viral Vector pGMLP-SPh-013 Human MAPK8 Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-056 Human MAPK8 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-153 Human MAPK8 Adenovirus plasmid
    ORF Viral Vector pGMAP-SPh-196 Human MAPK8 Adenovirus plasmid
    ORF Viral Vector pGMPC000125 Human MAPK8 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP005225 Human MAPK8 Lentivirus particle
    ORF Viral Vector vGMAD000121 Human MAPK8 Adenovirus particle
    ORF Viral Vector vGMLP-SPh-013 Human MAPK8 Lentivirus particle
    ORF Viral Vector vGMLP-SPh-056 Human MAPK8 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-153 Human MAPK8 Adenovirus particle
    ORF Viral Vector vGMAP-SPh-196 Human MAPK8 Adenovirus particle


    Target information

    Target ID GM-T40097
    Target Name JNK1
    Gene ID 5599, 26419, 711115, 116554, 101091310, 477746, 539941, 100051798
    Gene Symbol and Synonyms JNK,JNK-46,JNK1,JNK1A2,JNK21B1/2,MAPK8,PRKM8,SAPK1,SAPK1c
    Uniprot Accession P45983
    Uniprot Entry Name MK08_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000107643
    Target Classification Kinase, Tumor-associated antigen (TAA)

    The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is activated by various cell stimuli, and targets specific transcription factors, and thus mediates immediate-early gene expression in response to cell stimuli. The activation of this kinase by tumor-necrosis factor alpha (TNF-alpha) is found to be required for TNF-alpha induced apoptosis. This kinase is also involved in UV radiation induced apoptosis, which is thought to be related to cytochrom c-mediated cell death pathway. Studies of the mouse counterpart of this gene suggested that this kinase play a key role in T cell proliferation, apoptosis and differentiation. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Apr 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.