Human MAPK8/JNK/JNK-46 ORF/cDNA clone-Lentivirus particle (NM_001278547.1)
Cat. No.: vGMLP005225
Pre-made Human MAPK8/JNK/JNK-46 Lentiviral expression plasmid for MAPK8 lentivirus packaging, MAPK8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
JNK1/MAPK8/JNK products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP005225 | Human MAPK8 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP005225 |
Gene Name | MAPK8 |
Accession Number | NM_001278547.1 |
Gene ID | 5599 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1284 bp |
Gene Alias | JNK,JNK-46,JNK1,JNK1A2,JNK21B1/2,PRKM8,SAPK1,SAPK1c |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGAGCAGAAGCAAGCGTGACAACAATTTTTATAGTGTAGAGATTGGAGATTCTACATTCACAGTCCTGAAACGATATCAGAATTTAAAACCTATAGGCTCAGGAGCTCAAGGAATAGTATGCGCAGCTTATGATGCCATTCTTGAAAGAAATGTTGCAATCAAGAAGCTAAGCCGACCATTTCAGAATCAGACTCATGCCAAGCGGGCCTACAGAGAGCTAGTTCTTATGAAATGTGTTAATCACAAAAATATAATTGGCCTTTTGAATGTTTTCACACCACAGAAATCCCTAGAAGAATTTCAAGATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTTTGCCAAGTGATTCAGATGGAGCTAGATCATGAAAGAATGTCCTACCTTCTCTATCAGATGCTGTGTGGAATCAAGCACCTTCATTCTGCTGGAATTATTCATCGGGACTTAAAGCCCAGTAATATAGTAGTAAAATCTGATTGCACTTTGAAGATTCTTGACTTCGGTCTGGCCAGGACTGCAGGAACGAGTTTTATGATGACGCCTTATGTAGTGACTCGCTACTACAGAGCACCCGAGGTCATCCTTGGCATGGGCTACAAGGAAAACGTTGACATTTGGTCAGTTGGGTGCATCATGGGAGAAATGATCAAAGGTGGTGTTTTGTTCCCAGGTACAGATCATATTGATCAGTGGAATAAAGTTATTGAACAGCTTGGAACACCATGTCCTGAATTCATGAAGAAACTGCAACCAACAGTAAGGACTTACGTTGAAAACAGACCTAAATATGCTGGATATAGCTTTGAGAAACTCTTCCCTGATGTCCTTTTCCCAGCTGACTCAGAACACAACAAACTTAAAGCCAGTCAGGCAAGGGATTTGTTATCCAAAATGCTGGTAATAGATGCATCTAAAAGGATCTCTGTAGATGAAGCTCTCCAACACCCGTACATCAATGTCTGGTATGATCCTTCTGAAGCAGAAGCTCCACCACCAAAGATCCCTGACAAGCAGTTAGATGAAAGGGAACACACAATAGAAGAGTGGAAAGAATTGATATATAAGGAAGTTATGGACTTGGAGGAGAGAACCAAGAATGGAGTTATACGGGGGCAGCCCTCTCCTTTAGGTGCAGCAGTGATCAATGGCTCTCAGCATCCATCATCATCGTCGTCTGTCAATGATGTGTCTTCAATGTCAACAGATCCGACTTTGGCCTCTGATACAGACAGCAGTCTAGAAGCAGCAGCTGGGCCTCTGGGCTGCTGTAGATGA |
ORF Protein Sequence | MSRSKRDNNFYSVEIGDSTFTVLKRYQNLKPIGSGAQGIVCAAYDAILERNVAIKKLSRPFQNQTHAKRAYRELVLMKCVNHKNIIGLLNVFTPQKSLEEFQDVYIVMELMDANLCQVIQMELDHERMSYLLYQMLCGIKHLHSAGIIHRDLKPSNIVVKSDCTLKILDFGLARTAGTSFMMTPYVVTRYYRAPEVILGMGYKENVDIWSVGCIMGEMIKGGVLFPGTDHIDQWNKVIEQLGTPCPEFMKKLQPTVRTYVENRPKYAGYSFEKLFPDVLFPADSEHNKLKASQARDLLSKMLVIDASKRISVDEALQHPYINVWYDPSEAEAPPPKIPDKQLDEREHTIEEWKELIYKEVMDLEERTKNGVIRGQPSPLGAAVINGSQHPSSSSSVNDVSSMSTDPTLASDTDSSLEAAAGPLGCCR |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T40097-Ab | Anti-JNK1 monoclonal antibody |
Target Antigen | GM-Tg-g-T40097-Ag | JNK1/MAPK8 protein |
ORF Viral Vector | pGMLP005225 | Human MAPK8 Lentivirus plasmid |
ORF Viral Vector | pGMAD000121 | Human MAPK8 Adenovirus plasmid |
ORF Viral Vector | pGMLP-SPh-013 | Human MAPK8 Lentivirus plasmid |
ORF Viral Vector | pGMLP-SPh-056 | Human MAPK8 Lentivirus plasmid |
ORF Viral Vector | pGMAP-SPh-153 | Human MAPK8 Adenovirus plasmid |
ORF Viral Vector | pGMAP-SPh-196 | Human MAPK8 Adenovirus plasmid |
ORF Viral Vector | pGMPC000125 | Human MAPK8 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLP005225 | Human MAPK8 Lentivirus particle |
ORF Viral Vector | vGMAD000121 | Human MAPK8 Adenovirus particle |
ORF Viral Vector | vGMLP-SPh-013 | Human MAPK8 Lentivirus particle |
ORF Viral Vector | vGMLP-SPh-056 | Human MAPK8 Lentivirus particle |
ORF Viral Vector | vGMAP-SPh-153 | Human MAPK8 Adenovirus particle |
ORF Viral Vector | vGMAP-SPh-196 | Human MAPK8 Adenovirus particle |
Target information
Target ID | GM-T40097 |
Target Name | JNK1 |
Gene ID | 5599, 26419, 711115, 116554, 101091310, 477746, 539941, 100051798 |
Gene Symbol and Synonyms | JNK,JNK-46,JNK1,JNK1A2,JNK21B1/2,MAPK8,PRKM8,SAPK1,SAPK1c |
Uniprot Accession | P45983 |
Uniprot Entry Name | MK08_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000107643 |
Target Classification | Kinase, Tumor-associated antigen (TAA) |
The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is activated by various cell stimuli, and targets specific transcription factors, and thus mediates immediate-early gene expression in response to cell stimuli. The activation of this kinase by tumor-necrosis factor alpha (TNF-alpha) is found to be required for TNF-alpha induced apoptosis. This kinase is also involved in UV radiation induced apoptosis, which is thought to be related to cytochrom c-mediated cell death pathway. Studies of the mouse counterpart of this gene suggested that this kinase play a key role in T cell proliferation, apoptosis and differentiation. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Apr 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.