- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human NEU1/SIAL1 ORF/cDNA clone-Adenovirus plasmid (BC000722)
Pre-made Human NEU1/SIAL1 adenoviral expression plasmid for NEU1 adenovirus packaging, NEU1 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to NEU1/SIAL1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
|---|---|---|---|
| pGMAP000094 | Human NEU1 Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
| GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
| High Quality (HQ) Grade | |||
| Seed | 5ug |
Product Description
| Catalog ID | pGMAP000094 |
| Gene Name | NEU1 |
| Accession Number | BC000722 |
| Gene ID | 4758 |
| Species | Human |
| Product Type | Adenovirus plasmid (overexpression) |
| Insert Length | 1248 bp |
| Gene Alias | SIAL1 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGACTGGGGAGCGACCCAGCACGGCGCTCCCGGACAGACGCTGGGGGCCGCGGATTCTGGGCTTCTGGGGAGGCTGTAGGGTTTGGGTGTTTGCCGCGATCTTCCTGCTGCTGTCTCTGGCAGCCTCCTGGTCCAAGGCTGAGAACGACTTCGGTCTGGTGCAGCCGCTGGTGACCATGGAGCAACTGCTGTGGGTGAGCGGGAGACAGATCGGCTCAGTGGACACCTTCCGCATCCCGCTCATCACAGCCACTCCGCGGGGCACTCTTCTCGCCTTTGCTGAGGCGAGGAAAATGTCCTCATCCGATGAGGGGGCCAAGTTCATCGCCCTGCGGAGGTCCATGGACCAGGGCAGCACATGGTCTCCTACAGCGTTCATTGTCAATGATGGGGATGTCCCCGATGGGCTGAACCTTGGGGCAGTAGTGAGCGATGTTGAGACAGGAGTAGTATTTCTTTTCTACTCCCTTTGTGCTCACAAGGCCGGCTGCCAGGTGGCCTCTACCATGTTGGTATGGAGCAAGGATGATGGTGTTTCCTGGAGCACACCCCGGAATCTCTCCCTGGATATTGGCACTGAAGTGTTTGCCCCTGGACCGGGCTCTGGTATTCAGAAACAGCGGGAGCCACGGAAGGGCCGCCTCATCGTGTGTGGCCATGGGACGCTGGAGCGGGACGGAGTCTTCTGTCTCCTCAGCGATGATCATGGTGCCTCCTGGCGCTACGGAAGTGGGGTCAGCGGCATCCCCTACGGTCAGCCCAAGCAGGAAAATGATTTCAATCCTGATGAATGCCAGCCCTATGAGCTCCCAGATGGCTCAGTCGTCATCAATGCCCGAAACCAGAACAACTACCACTGCCACTGCCGAATTGTCCTCCGCAGCTATGATGCCTGTGATACACTAAGGCCCCGTGATGTGACCTTCGACCCTGAGCTCGTGGACCCTGTGGTAGCTGCAGGAGCTGTAGTCACCAGCTCCGGCATTGTCTTCTTCTCCAACCCAGCACATCCAGAGTTCCGAGTGAACCTGACCCTGCGATGGAGCTTCAGCAATGGTACCTCATGGCGGAAAGAGACAGTCCAGCTATGGCCAGGCCCCAGTGGCTATTCATCCCTGGCAACCCTGGAGGGCAGCATGGATGGAGAGGAGCAGGCCCCCCAGCTCTACGTCCTGTATGAGAAAGGCCGGAACCACTACACAGAGAGCATCTCCGTGGCCAAAATCAGTGTCTATGGGACACTCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-MP0874-Ab | Anti-NEUR1/ NEU1/ NANH monoclonal antibody |
| Target Antigen | GM-Tg-g-MP0874-Ag | NEU1 VLP (virus-like particle) |
| ORF Viral Vector | pGMAAV000260 | Human NEU1 Adeno-associate virus(AAV) plasmid |
| ORF Viral Vector | pGMAAV000796 | Human NEU1 Adeno-associate virus(AAV) plasmid |
| ORF Viral Vector | pGMAAV001253 | Human NEU1 Adeno-associate virus(AAV) plasmid |
| ORF Viral Vector | pGMAP000094 | Human NEU1 Adenovirus plasmid |
| ORF Viral Vector | vGMAAV000260 | Human NEU1 Adeno-associate virus(AAV) particle |
| ORF Viral Vector | vGMAAV000796 | Human NEU1 Adeno-associate virus(AAV) particle |
| ORF Viral Vector | vGMAAV001253 | Human NEU1 Adeno-associate virus(AAV) particle |
| ORF Viral Vector | vGMAP000094 | Human NEU1 Adenovirus particle |
Target information
| Target ID | GM-MP0874 |
| Target Name | NEU1 |
| Gene ID | 4758, 18010, 716740, 24591, 101091282, 481717, 505554, 100059083 |
| Gene Symbol and Synonyms | Aglp,Apl,Bat-7,Bat7,G9,Map-2,NANH,NEU,Neu-1,NEU1,SIAL1 |
| Uniprot Accession | Q99519 |
| Uniprot Entry Name | NEUR1_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000204386 |
| Target Classification | Not Available |
The protein encoded by this gene is a lysosomal enzyme that cleaves terminal sialic acid residues from substrates such as glycoproteins and glycolipids. In the lysosome, this enzyme is part of a heterotrimeric complex together with beta-galactosidase and cathepsin A (the latter is also referred to as 'protective protein'). Mutations in this gene can lead to sialidosis, a lysosomal storage disease that can be type 1 (cherry red spot-myoclonus syndrome or normosomatic type), which is late-onset, or type 2 (the dysmorphic type), which occurs at an earlier age with increased severity. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
