Human PMP22/CMT1A/CMT1E ORF/cDNA clone-Adenovirus plasmid (BC019040)

Cat. No.: pGMAP000148
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PMP22/CMT1A/CMT1E adenoviral expression plasmid for PMP22 adenovirus packaging, PMP22 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.


Target products collection

Go to PMP22/CMT1A products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP000148
Gene Name PMP22
Accession Number BC019040
Gene ID 5376
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 483 bp
Gene Alias CMT1A,CMT1E,DSS,GAS-3,HMSNIA,HNPP,MGC20769,Sp110
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGCTCCTCCTGTTGCTGAGTATCATCGTCCTCCACGTCGCGGTGCTGGTGCTGCTGTTCGTCTCCACGATCGTCAGCCAATGGATCGTGGGCAATGGACACGCAACTGATCTCTGGCAGAACTGTAGCACCTCTTCCTCAGGAAATGTCCACCACTGTTTCTCATCATCACCAAACGAATGGCTGCAGTCTGTCCAGGCCACCATGATCCTGTCGATCATCTTCAGCATTCTGTCTCTGTTCCTGTTCTTCTGCCAACTCTTCACCCTCACCAAGGGGGGCAGGTTTTACATCACTGGAATCTTCCAAATTCTTGCTGGTCTGTGCGTGATGAGTGCTGCGGCCATCTACACGGTGAGGCACCCGGAGTGGCATCTCAACTCGGATTACTCCTACGGTTTCGCCTACATCCTGGCCTGGGTGGCCTTCCCCCTGGCCCTTCTCAGCGGTGTCATCTATGTGATCTTGCGGAAACGCGAATGA
ORF Protein Sequence MLLLLLSIIVLHVAVLVLLFVSTIVSQWIVGNGHATDLWQNCSTSSSGNVHHCFSSSPNEWLQSVQATMILSIIFSILSLFLFFCQLFTLTKGGRFYITGIFQILAGLCVMSAAAIYTVRHPEWHLNSDYSYGFAYILAWVAFPLALLSGVIYVILRKRE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1395-Ab Anti-PMP22/ CIDP/ CMT1A monoclonal antibody
    Target Antigen GM-Tg-g-MP1395-Ag PMP22 VLP (virus-like particle)
    ORF Viral Vector pGMLP000512 Human PMP22 Lentivirus plasmid
    ORF Viral Vector pGMAP000148 Human PMP22 Adenovirus plasmid
    ORF Viral Vector vGMLP000512 Human PMP22 Lentivirus particle
    ORF Viral Vector vGMAP000148 Human PMP22 Adenovirus particle


    Target information

    Target ID GM-MP1395
    Target Name PMP22
    Gene ID 5376, 18858, 693527, 24660, 101092215, 479509, 534497, 100034146
    Gene Symbol and Synonyms CIDP,CMT1A,CMT1E,DSS,GAS-3,GAS3,HMSNIA,HNPP,PMP-22,PMP22,Sp110,Tr,TRE002,trembler
    Uniprot Accession Q01453
    Uniprot Entry Name PMP22_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000109099
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes an integral membrane protein that is a major component of myelin in the peripheral nervous system. Studies suggest two alternately used promoters drive tissue-specific expression. Various mutations of this gene are causes of Charcot-Marie-Tooth disease Type IA, Dejerine-Sottas syndrome, and hereditary neuropathy with liability to pressure palsies. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.